← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 1-155235749-GGGACTGTCGACAAAGTTACGCACCCAATTGGGTCCTCCTTCGGGGTTCAGGGCAA-G (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=1&pos=155235749&ref=GGGACTGTCGACAAAGTTACGCACCCAATTGGGTCCTCCTTCGGGGTTCAGGGCAA&alt=G&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "1",
      "pos": 155235749,
      "ref": "GGGACTGTCGACAAAGTTACGCACCCAATTGGGTCCTCCTTCGGGGTTCAGGGCAA",
      "alt": "G",
      "effect": "frameshift_variant",
      "transcript": "ENST00000368373.8",
      "consequences": [
        {
          "aa_ref": "LALNPEGGPNWVRNFVDSP",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 11,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "GBA1",
          "gene_hgnc_id": 4177,
          "hgvs_c": "c.1265_1319delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC",
          "hgvs_p": "p.Leu422fs",
          "transcript": "NM_000157.4",
          "protein_id": "NP_000148.2",
          "transcript_support_level": null,
          "aa_start": 422,
          "aa_end": null,
          "aa_length": 536,
          "cds_start": 1265,
          "cds_end": null,
          "cds_length": 1611,
          "cdna_start": 1456,
          "cdna_end": null,
          "cdna_length": 2291,
          "mane_select": "ENST00000368373.8",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "LALNPEGGPNWVRNFVDSP",
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 11,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "GBA1",
          "gene_hgnc_id": 4177,
          "hgvs_c": "c.1265_1319delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC",
          "hgvs_p": "p.Leu422fs",
          "transcript": "ENST00000368373.8",
          "protein_id": "ENSP00000357357.3",
          "transcript_support_level": 1,
          "aa_start": 422,
          "aa_end": null,
          "aa_length": 536,
          "cds_start": 1265,
          "cds_end": null,
          "cds_length": 1611,
          "cdna_start": 1456,
          "cdna_end": null,
          "cdna_length": 2291,
          "mane_select": "NM_000157.4",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "LALNPEGGPNWVRNFVDSP",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 10,
          "exon_rank_end": null,
          "exon_count": 12,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "GBA1",
          "gene_hgnc_id": 4177,
          "hgvs_c": "c.1265_1319delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC",
          "hgvs_p": "p.Leu422fs",
          "transcript": "ENST00000327247.9",
          "protein_id": "ENSP00000314508.5",
          "transcript_support_level": 1,
          "aa_start": 422,
          "aa_end": null,
          "aa_length": 536,
          "cds_start": 1265,
          "cds_end": null,
          "cds_length": 1611,
          "cdna_start": 1552,
          "cdna_end": null,
          "cdna_length": 2387,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "LALNPEGGPNWVRNFVDSP",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 10,
          "exon_rank_end": null,
          "exon_count": 12,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "GBA1",
          "gene_hgnc_id": 4177,
          "hgvs_c": "c.1265_1319delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC",
          "hgvs_p": "p.Leu422fs",
          "transcript": "NM_001005741.3",
          "protein_id": "NP_001005741.1",
          "transcript_support_level": null,
          "aa_start": 422,
          "aa_end": null,
          "aa_length": 536,
          "cds_start": 1265,
          "cds_end": null,
          "cds_length": 1611,
          "cdna_start": 1509,
          "cdna_end": null,
          "cdna_length": 2344,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "LALNPEGGPNWVRNFVDSP",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 10,
          "exon_rank_end": null,
          "exon_count": 12,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "GBA1",
          "gene_hgnc_id": 4177,
          "hgvs_c": "c.1265_1319delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC",
          "hgvs_p": "p.Leu422fs",
          "transcript": "NM_001005742.3",
          "protein_id": "NP_001005742.1",
          "transcript_support_level": null,
          "aa_start": 422,
          "aa_end": null,
          "aa_length": 536,
          "cds_start": 1265,
          "cds_end": null,
          "cds_length": 1611,
          "cdna_start": 1490,
          "cdna_end": null,
          "cdna_length": 2325,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "LALNPEGGPNWVRNFVDSP",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "GBA1",
          "gene_hgnc_id": 4177,
          "hgvs_c": "c.1118_1172delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC",
          "hgvs_p": "p.Leu373fs",
          "transcript": "NM_001171812.2",
          "protein_id": "NP_001165283.1",
          "transcript_support_level": null,
          "aa_start": 373,
          "aa_end": null,
          "aa_length": 487,
          "cds_start": 1118,
          "cds_end": null,
          "cds_length": 1464,
          "cdna_start": 1309,
          "cdna_end": null,
          "cdna_length": 2144,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "LALNPEGGPNWVRNFVDSP",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "GBA1",
          "gene_hgnc_id": 4177,
          "hgvs_c": "c.1118_1172delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC",
          "hgvs_p": "p.Leu373fs",
          "transcript": "ENST00000427500.7",
          "protein_id": "ENSP00000402577.2",
          "transcript_support_level": 2,
          "aa_start": 373,
          "aa_end": null,
          "aa_length": 487,
          "cds_start": 1118,
          "cds_end": null,
          "cds_length": 1464,
          "cdna_start": 1335,
          "cdna_end": null,
          "cdna_length": 2063,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "LALNPEGGPNWVRNFVDSP",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "GBA1",
          "gene_hgnc_id": 4177,
          "hgvs_c": "c.1004_1058delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC",
          "hgvs_p": "p.Leu335fs",
          "transcript": "NM_001171811.2",
          "protein_id": "NP_001165282.1",
          "transcript_support_level": null,
          "aa_start": 335,
          "aa_end": null,
          "aa_length": 449,
          "cds_start": 1004,
          "cds_end": null,
          "cds_length": 1350,
          "cdna_start": 1326,
          "cdna_end": null,
          "cdna_length": 2161,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "LALNPEGGPNWVRNFVDSP",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "GBA1",
          "gene_hgnc_id": 4177,
          "hgvs_c": "c.1004_1058delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC",
          "hgvs_p": "p.Leu335fs",
          "transcript": "ENST00000428024.3",
          "protein_id": "ENSP00000397986.2",
          "transcript_support_level": 2,
          "aa_start": 335,
          "aa_end": null,
          "aa_length": 449,
          "cds_start": 1004,
          "cds_end": null,
          "cds_length": 1350,
          "cdna_start": 1398,
          "cdna_end": null,
          "cdna_length": 1817,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 2,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "GBA1",
          "gene_hgnc_id": 4177,
          "hgvs_c": "n.32_86delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC",
          "hgvs_p": null,
          "transcript": "ENST00000464536.1",
          "protein_id": null,
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 559,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 3,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "GBA1",
          "gene_hgnc_id": 4177,
          "hgvs_c": "n.256_310delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC",
          "hgvs_p": null,
          "transcript": "ENST00000478472.1",
          "protein_id": null,
          "transcript_support_level": 3,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1005,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "GBA1",
          "gene_hgnc_id": 4177,
          "hgvs_c": "n.424_478delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC",
          "hgvs_p": null,
          "transcript": "ENST00000484489.5",
          "protein_id": null,
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 749,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "GBA1",
      "gene_hgnc_id": 4177,
      "dbsnp": "rs80356768",
      "frequency_reference_population": null,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 0,
      "gnomad_exomes_af": null,
      "gnomad_genomes_af": null,
      "gnomad_exomes_ac": null,
      "gnomad_genomes_ac": null,
      "gnomad_exomes_homalt": null,
      "gnomad_genomes_homalt": null,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 8.467,
      "phylop100way_prediction": "Pathogenic",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 16,
      "acmg_classification": "Pathogenic",
      "acmg_criteria": "PVS1,PP5_Very_Strong",
      "acmg_by_gene": [
        {
          "score": 16,
          "benign_score": 0,
          "pathogenic_score": 16,
          "criteria": [
            "PVS1",
            "PP5_Very_Strong"
          ],
          "verdict": "Pathogenic",
          "transcript": "ENST00000368373.8",
          "gene_symbol": "GBA1",
          "hgnc_id": 4177,
          "effects": [
            "frameshift_variant"
          ],
          "inheritance_mode": "AD,AR",
          "hgvs_c": "c.1265_1319delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC",
          "hgvs_p": "p.Leu422fs"
        }
      ],
      "clinvar_disease": "7 conditions,Gaucher disease,Gaucher disease perinatal lethal,Gaucher disease type I,not provided",
      "clinvar_classification": "Pathogenic",
      "clinvar_review_status": "criteria provided, multiple submitters, no conflicts",
      "clinvar_submissions_summary": "P:5 O:1",
      "phenotype_combined": "Gaucher disease|Gaucher disease perinatal lethal|Gaucher disease type I|not provided|7 conditions",
      "pathogenicity_classification_combined": "Pathogenic",
      "custom_annotations": null
    }
  ],
  "message": null
}