← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 1-219927887-GGGGCTGTCGGGTCCGCCGCGCGCCGCGGGTCCTCCGCGCCCTGAGGCCCCCCGAAAGC-G (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=1&pos=219927887&ref=GGGGCTGTCGGGTCCGCCGCGCGCCGCGGGTCCTCCGCGCCCTGAGGCCCCCCGAAAGC&alt=G&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "1",
"pos": 219927887,
"ref": "GGGGCTGTCGGGTCCGCCGCGCGCCGCGGGTCCTCCGCGCCCTGAGGCCCCCCGAAAGC",
"alt": "G",
"effect": "frameshift_variant",
"transcript": "ENST00000366926.4",
"consequences": [
{
"aa_ref": "AFGGPQGAEDPRRAADPTAP",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SLC30A10",
"gene_hgnc_id": 25355,
"hgvs_c": "c.496_553delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC",
"hgvs_p": "p.Ala166fs",
"transcript": "NM_018713.3",
"protein_id": "NP_061183.2",
"transcript_support_level": null,
"aa_start": 166,
"aa_end": null,
"aa_length": 485,
"cds_start": 496,
"cds_end": null,
"cds_length": 1458,
"cdna_start": 670,
"cdna_end": null,
"cdna_length": 6579,
"mane_select": "ENST00000366926.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "AFGGPQGAEDPRRAADPTAP",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SLC30A10",
"gene_hgnc_id": 25355,
"hgvs_c": "c.496_553delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC",
"hgvs_p": "p.Ala166fs",
"transcript": "ENST00000366926.4",
"protein_id": "ENSP00000355893.4",
"transcript_support_level": 1,
"aa_start": 166,
"aa_end": null,
"aa_length": 485,
"cds_start": 496,
"cds_end": null,
"cds_length": 1458,
"cdna_start": 670,
"cdna_end": null,
"cdna_length": 6579,
"mane_select": "NM_018713.3",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SLC30A10",
"gene_hgnc_id": 25355,
"hgvs_c": "n.496_553delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC",
"hgvs_p": null,
"transcript": "ENST00000356609.2",
"protein_id": "ENSP00000349018.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3650,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SLC30A10",
"gene_hgnc_id": 25355,
"hgvs_c": "c.-218_-161delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC",
"hgvs_p": null,
"transcript": "NM_001416005.1",
"protein_id": "NP_001402934.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 260,
"cds_start": -4,
"cds_end": null,
"cds_length": 783,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6617,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "SLC30A10",
"gene_hgnc_id": 25355,
"hgvs_c": "c.452-840_452-783delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC",
"hgvs_p": null,
"transcript": "NM_001376929.1",
"protein_id": "NP_001363858.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 422,
"cds_start": -4,
"cds_end": null,
"cds_length": 1269,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6353,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "SLC30A10",
"gene_hgnc_id": 25355,
"hgvs_c": "c.452-840_452-783delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC",
"hgvs_p": null,
"transcript": "ENST00000696608.1",
"protein_id": "ENSP00000512752.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 422,
"cds_start": -4,
"cds_end": null,
"cds_length": 1269,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6273,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "SLC30A10",
"gene_hgnc_id": 25355,
"hgvs_c": "n.81-840_81-783delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC",
"hgvs_p": null,
"transcript": "ENST00000484239.5",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1902,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "SLC30A10",
"gene_hgnc_id": 25355,
"dbsnp": "rs1553313783",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 0.439,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 8,
"acmg_classification": "Likely_pathogenic",
"acmg_criteria": "PVS1",
"acmg_by_gene": [
{
"score": 8,
"benign_score": 0,
"pathogenic_score": 8,
"criteria": [
"PVS1"
],
"verdict": "Likely_pathogenic",
"transcript": "ENST00000366926.4",
"gene_symbol": "SLC30A10",
"hgnc_id": 25355,
"effects": [
"frameshift_variant"
],
"inheritance_mode": "AR",
"hgvs_c": "c.496_553delGCTTTCGGGGGGCCTCAGGGCGCGGAGGACCCGCGGCGCGCGGCGGACCCGACAGCCC",
"hgvs_p": "p.Ala166fs"
}
],
"clinvar_disease": " and cirrhosis, polycythemia,Hypermanganesemia with dystonia",
"clinvar_classification": "not provided",
"clinvar_review_status": "no classification provided",
"clinvar_submissions_summary": "O:1",
"phenotype_combined": "Hypermanganesemia with dystonia, polycythemia, and cirrhosis",
"pathogenicity_classification_combined": "not provided",
"custom_annotations": null
}
],
"message": null
}