← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 1-26696421-C-CCCCGCCGCCGCCAGCAGCCTGGGCAA (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=1&pos=26696421&ref=C&alt=CCCCGCCGCCGCCAGCAGCCTGGGCAA&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "1",
"pos": 26696421,
"ref": "C",
"alt": "CCCCGCCGCCGCCAGCAGCCTGGGCAA",
"effect": "frameshift_variant",
"transcript": "ENST00000324856.13",
"consequences": [
{
"aa_ref": "P",
"aa_alt": "PAAWATRRR?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ARID1A",
"gene_hgnc_id": 11110,
"hgvs_c": "c.31_56dupAGCAGCCTGGGCAACCCGCCGCCGCC",
"hgvs_p": "p.Pro20fs",
"transcript": "NM_006015.6",
"protein_id": "NP_006006.3",
"transcript_support_level": null,
"aa_start": 19,
"aa_end": null,
"aa_length": 2285,
"cds_start": 57,
"cds_end": null,
"cds_length": 6858,
"cdna_start": 446,
"cdna_end": null,
"cdna_length": 8595,
"mane_select": "ENST00000324856.13",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "P",
"aa_alt": "PAAWATRRR?",
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ARID1A",
"gene_hgnc_id": 11110,
"hgvs_c": "c.31_56dupAGCAGCCTGGGCAACCCGCCGCCGCC",
"hgvs_p": "p.Pro20fs",
"transcript": "ENST00000324856.13",
"protein_id": "ENSP00000320485.7",
"transcript_support_level": 1,
"aa_start": 19,
"aa_end": null,
"aa_length": 2285,
"cds_start": 57,
"cds_end": null,
"cds_length": 6858,
"cdna_start": 446,
"cdna_end": null,
"cdna_length": 8595,
"mane_select": "NM_006015.6",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "P",
"aa_alt": "PAAWATRRR?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ARID1A",
"gene_hgnc_id": 11110,
"hgvs_c": "c.31_56dupAGCAGCCTGGGCAACCCGCCGCCGCC",
"hgvs_p": "p.Pro20fs",
"transcript": "ENST00000850904.1",
"protein_id": "ENSP00000520984.1",
"transcript_support_level": null,
"aa_start": 19,
"aa_end": null,
"aa_length": 2275,
"cds_start": 57,
"cds_end": null,
"cds_length": 6828,
"cdna_start": 446,
"cdna_end": null,
"cdna_length": 8565,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "P",
"aa_alt": "PAAWATRRR?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ARID1A",
"gene_hgnc_id": 11110,
"hgvs_c": "c.31_56dupAGCAGCCTGGGCAACCCGCCGCCGCC",
"hgvs_p": "p.Pro20fs",
"transcript": "NM_139135.4",
"protein_id": "NP_624361.1",
"transcript_support_level": null,
"aa_start": 19,
"aa_end": null,
"aa_length": 2068,
"cds_start": 57,
"cds_end": null,
"cds_length": 6207,
"cdna_start": 446,
"cdna_end": null,
"cdna_length": 7944,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "P",
"aa_alt": "PAAWATRRR?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ARID1A",
"gene_hgnc_id": 11110,
"hgvs_c": "c.31_56dupAGCAGCCTGGGCAACCCGCCGCCGCC",
"hgvs_p": "p.Pro20fs",
"transcript": "ENST00000457599.7",
"protein_id": "ENSP00000387636.2",
"transcript_support_level": 5,
"aa_start": 19,
"aa_end": null,
"aa_length": 2068,
"cds_start": 57,
"cds_end": null,
"cds_length": 6207,
"cdna_start": 1297,
"cdna_end": null,
"cdna_length": 7508,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "ARID1A",
"gene_hgnc_id": 11110,
"hgvs_c": "c.-13+2817_-13+2842dupAGCAGCCTGGGCAACCCGCCGCCGCC",
"hgvs_p": null,
"transcript": "ENST00000430799.7",
"protein_id": "ENSP00000390317.3",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 1901,
"cds_start": -4,
"cds_end": null,
"cds_length": 5706,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6521,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "ARID1A",
"gene_hgnc_id": 11110,
"hgvs_c": "c.-13+334_-13+359dupAGCAGCCTGGGCAACCCGCCGCCGCC",
"hgvs_p": null,
"transcript": "ENST00000637465.1",
"protein_id": "ENSP00000490650.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 205,
"cds_start": -4,
"cds_end": null,
"cds_length": 618,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 699,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LOC124900417",
"gene_hgnc_id": null,
"hgvs_c": "c.-42_-17dupTTGCCCAGGCTGCTGGCGGCGGCGGG",
"hgvs_p": null,
"transcript": "XM_047439473.1",
"protein_id": "XP_047295429.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 291,
"cds_start": -4,
"cds_end": null,
"cds_length": 876,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4247,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "ARID1A",
"gene_hgnc_id": 11110,
"dbsnp": "rs797045262",
"frequency_reference_population": 8.7741773e-7,
"hom_count_reference_population": 0,
"allele_count_reference_population": 1,
"gnomad_exomes_af": 8.77418e-7,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": 1,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": 0,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 2.254,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 8,
"acmg_classification": "Likely_pathogenic",
"acmg_criteria": "PVS1",
"acmg_by_gene": [
{
"score": 8,
"benign_score": 0,
"pathogenic_score": 8,
"criteria": [
"PVS1"
],
"verdict": "Likely_pathogenic",
"transcript": "ENST00000324856.13",
"gene_symbol": "ARID1A",
"hgnc_id": 11110,
"effects": [
"frameshift_variant"
],
"inheritance_mode": "AD",
"hgvs_c": "c.31_56dupAGCAGCCTGGGCAACCCGCCGCCGCC",
"hgvs_p": "p.Pro20fs"
},
{
"score": 0,
"benign_score": 0,
"pathogenic_score": 0,
"criteria": [],
"verdict": "Uncertain_significance",
"transcript": "XM_047439473.1",
"gene_symbol": "LOC124900417",
"hgnc_id": null,
"effects": [
"upstream_gene_variant"
],
"inheritance_mode": "",
"hgvs_c": "c.-42_-17dupTTGCCCAGGCTGCTGGCGGCGGCGGG",
"hgvs_p": null
}
],
"clinvar_disease": "",
"clinvar_classification": "",
"clinvar_review_status": "",
"clinvar_submissions_summary": "",
"phenotype_combined": null,
"pathogenicity_classification_combined": null,
"custom_annotations": null
}
],
"message": null
}