← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 1-45329351-AGACCGAAAGAAATTATCCAGGACTTGCTGGCCCATGCGGGGCTTTTTCC-A (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=1&pos=45329351&ref=AGACCGAAAGAAATTATCCAGGACTTGCTGGCCCATGCGGGGCTTTTTCC&alt=A&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "1",
      "pos": 45329351,
      "ref": "AGACCGAAAGAAATTATCCAGGACTTGCTGGCCCATGCGGGGCTTTTTCC",
      "alt": "A",
      "effect": "frameshift_variant",
      "transcript": "ENST00000456914.7",
      "consequences": [
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1556_1604delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg519fs",
          "transcript": "NM_001128425.2",
          "protein_id": "NP_001121897.1",
          "transcript_support_level": null,
          "aa_start": 519,
          "aa_end": null,
          "aa_length": 549,
          "cds_start": 1556,
          "cds_end": null,
          "cds_length": 1650,
          "cdna_start": 1790,
          "cdna_end": null,
          "cdna_length": 1900,
          "mane_select": null,
          "mane_plus": "ENST00000710952.2",
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1556_1604delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg519fs",
          "transcript": "ENST00000710952.2",
          "protein_id": "ENSP00000518552.2",
          "transcript_support_level": null,
          "aa_start": 519,
          "aa_end": null,
          "aa_length": 549,
          "cds_start": 1556,
          "cds_end": null,
          "cds_length": 1650,
          "cdna_start": 1790,
          "cdna_end": null,
          "cdna_length": 1900,
          "mane_select": null,
          "mane_plus": "NM_001128425.2",
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg491fs",
          "transcript": "NM_001048174.2",
          "protein_id": "NP_001041639.1",
          "transcript_support_level": null,
          "aa_start": 491,
          "aa_end": null,
          "aa_length": 521,
          "cds_start": 1472,
          "cds_end": null,
          "cds_length": 1566,
          "cdna_start": 1598,
          "cdna_end": null,
          "cdna_length": 1708,
          "mane_select": "ENST00000456914.7",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg491fs",
          "transcript": "ENST00000456914.7",
          "protein_id": "ENSP00000407590.2",
          "transcript_support_level": 1,
          "aa_start": 491,
          "aa_end": null,
          "aa_length": 521,
          "cds_start": 1472,
          "cds_end": null,
          "cds_length": 1566,
          "cdna_start": 1598,
          "cdna_end": null,
          "cdna_length": 1708,
          "mane_select": "NM_001048174.2",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1547_1595delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg516fs",
          "transcript": "ENST00000372098.7",
          "protein_id": "ENSP00000361170.3",
          "transcript_support_level": 1,
          "aa_start": 516,
          "aa_end": null,
          "aa_length": 546,
          "cds_start": 1547,
          "cds_end": null,
          "cds_length": 1641,
          "cdna_start": 1729,
          "cdna_end": null,
          "cdna_length": 1839,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1517_1565delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg506fs",
          "transcript": "ENST00000372110.7",
          "protein_id": "ENSP00000361182.3",
          "transcript_support_level": 1,
          "aa_start": 506,
          "aa_end": null,
          "aa_length": 536,
          "cds_start": 1517,
          "cds_end": null,
          "cds_length": 1611,
          "cdna_start": 1699,
          "cdna_end": null,
          "cdna_length": 1809,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1514_1562delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg505fs",
          "transcript": "ENST00000372115.7",
          "protein_id": "ENSP00000361187.3",
          "transcript_support_level": 1,
          "aa_start": 505,
          "aa_end": null,
          "aa_length": 535,
          "cds_start": 1514,
          "cds_end": null,
          "cds_length": 1608,
          "cdna_start": 1778,
          "cdna_end": null,
          "cdna_length": 1888,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1505_1553delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg502fs",
          "transcript": "ENST00000448481.5",
          "protein_id": "ENSP00000409718.1",
          "transcript_support_level": 1,
          "aa_start": 502,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 1505,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1596,
          "cdna_end": null,
          "cdna_length": 1706,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1475_1523delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg492fs",
          "transcript": "ENST00000354383.10",
          "protein_id": "ENSP00000346354.6",
          "transcript_support_level": 1,
          "aa_start": 492,
          "aa_end": null,
          "aa_length": 522,
          "cds_start": 1475,
          "cds_end": null,
          "cds_length": 1569,
          "cdna_start": 1634,
          "cdna_end": null,
          "cdna_length": 1744,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg491fs",
          "transcript": "ENST00000355498.6",
          "protein_id": "ENSP00000347685.2",
          "transcript_support_level": 1,
          "aa_start": 491,
          "aa_end": null,
          "aa_length": 521,
          "cds_start": 1472,
          "cds_end": null,
          "cds_length": 1566,
          "cdna_start": 1666,
          "cdna_end": null,
          "cdna_length": 1776,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg491fs",
          "transcript": "ENST00000372104.5",
          "protein_id": "ENSP00000361176.1",
          "transcript_support_level": 1,
          "aa_start": 491,
          "aa_end": null,
          "aa_length": 521,
          "cds_start": 1472,
          "cds_end": null,
          "cds_length": 1566,
          "cdna_start": 1713,
          "cdna_end": null,
          "cdna_length": 1823,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.*1285_*1333delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "ENST00000475516.5",
          "protein_id": "ENSP00000433843.1",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1677,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.*1285_*1333delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "ENST00000481571.5",
          "protein_id": "ENSP00000436597.1",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1742,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": true,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 21,
          "exon_rank_end": null,
          "exon_count": 21,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "ENSG00000288208",
          "gene_hgnc_id": null,
          "hgvs_c": "n.*215_*263delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "ENST00000671898.1",
          "protein_id": "ENSP00000499896.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2768,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.*1285_*1333delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "ENST00000475516.5",
          "protein_id": "ENSP00000433843.1",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1677,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.*1285_*1333delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "ENST00000481571.5",
          "protein_id": "ENSP00000436597.1",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1742,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": true,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 21,
          "exon_rank_end": null,
          "exon_count": 21,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "ENSG00000288208",
          "gene_hgnc_id": null,
          "hgvs_c": "n.*215_*263delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "ENST00000671898.1",
          "protein_id": "ENSP00000499896.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2768,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1547_1595delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg516fs",
          "transcript": "NM_012222.3",
          "protein_id": "NP_036354.1",
          "transcript_support_level": null,
          "aa_start": 516,
          "aa_end": null,
          "aa_length": 546,
          "cds_start": 1547,
          "cds_end": null,
          "cds_length": 1641,
          "cdna_start": 1781,
          "cdna_end": null,
          "cdna_length": 1891,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1547_1595delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg516fs",
          "transcript": "ENST00000672818.3",
          "protein_id": "ENSP00000500891.1",
          "transcript_support_level": null,
          "aa_start": 516,
          "aa_end": null,
          "aa_length": 546,
          "cds_start": 1547,
          "cds_end": null,
          "cds_length": 1641,
          "cdna_start": 1781,
          "cdna_end": null,
          "cdna_length": 1891,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1517_1565delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg506fs",
          "transcript": "NM_001293190.2",
          "protein_id": "NP_001280119.1",
          "transcript_support_level": null,
          "aa_start": 506,
          "aa_end": null,
          "aa_length": 536,
          "cds_start": 1517,
          "cds_end": null,
          "cds_length": 1611,
          "cdna_start": 1751,
          "cdna_end": null,
          "cdna_length": 1861,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1514_1562delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg505fs",
          "transcript": "NM_001407083.1",
          "protein_id": "NP_001394012.1",
          "transcript_support_level": null,
          "aa_start": 505,
          "aa_end": null,
          "aa_length": 535,
          "cds_start": 1514,
          "cds_end": null,
          "cds_length": 1608,
          "cdna_start": 1713,
          "cdna_end": null,
          "cdna_length": 1823,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1514_1562delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg505fs",
          "transcript": "NM_001407085.1",
          "protein_id": "NP_001394014.1",
          "transcript_support_level": null,
          "aa_start": 505,
          "aa_end": null,
          "aa_length": 535,
          "cds_start": 1514,
          "cds_end": null,
          "cds_length": 1608,
          "cdna_start": 1640,
          "cdna_end": null,
          "cdna_length": 1750,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1514_1562delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg505fs",
          "transcript": "ENST00000528013.6",
          "protein_id": "ENSP00000433130.2",
          "transcript_support_level": 5,
          "aa_start": 505,
          "aa_end": null,
          "aa_length": 535,
          "cds_start": 1514,
          "cds_end": null,
          "cds_length": 1608,
          "cdna_start": 1616,
          "cdna_end": null,
          "cdna_length": 1662,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1505_1553delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg502fs",
          "transcript": "NM_001293191.2",
          "protein_id": "NP_001280120.1",
          "transcript_support_level": null,
          "aa_start": 502,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 1505,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1631,
          "cdna_end": null,
          "cdna_length": 1741,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 15,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1505_1553delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg502fs",
          "transcript": "NM_001407069.1",
          "protein_id": "NP_001393998.1",
          "transcript_support_level": null,
          "aa_start": 502,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 1505,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1739,
          "cdna_end": null,
          "cdna_length": 1849,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1505_1553delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg502fs",
          "transcript": "NM_001407077.1",
          "protein_id": "NP_001394006.1",
          "transcript_support_level": null,
          "aa_start": 502,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 1505,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1704,
          "cdna_end": null,
          "cdna_length": 1814,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1505_1553delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg502fs",
          "transcript": "ENST00000435155.2",
          "protein_id": "ENSP00000403655.2",
          "transcript_support_level": 5,
          "aa_start": 502,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 1505,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1704,
          "cdna_end": null,
          "cdna_length": 1801,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1493_1541delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg498fs",
          "transcript": "NM_001407087.1",
          "protein_id": "NP_001394016.1",
          "transcript_support_level": null,
          "aa_start": 498,
          "aa_end": null,
          "aa_length": 528,
          "cds_start": 1493,
          "cds_end": null,
          "cds_length": 1587,
          "cdna_start": 2072,
          "cdna_end": null,
          "cdna_length": 2182,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 18,
          "exon_rank_end": null,
          "exon_count": 18,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1493_1541delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg498fs",
          "transcript": "ENST00000713751.1",
          "protein_id": "ENSP00000519052.1",
          "transcript_support_level": null,
          "aa_start": 498,
          "aa_end": null,
          "aa_length": 528,
          "cds_start": 1493,
          "cds_end": null,
          "cds_length": 1587,
          "cdna_start": 1834,
          "cdna_end": null,
          "cdna_length": 1942,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1490_1538delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg497fs",
          "transcript": "ENST00000483127.2",
          "protein_id": "ENSP00000436469.2",
          "transcript_support_level": 5,
          "aa_start": 497,
          "aa_end": null,
          "aa_length": 527,
          "cds_start": 1490,
          "cds_end": null,
          "cds_length": 1584,
          "cdna_start": 2044,
          "cdna_end": null,
          "cdna_length": 2154,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1475_1523delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg492fs",
          "transcript": "NM_001048172.2",
          "protein_id": "NP_001041637.1",
          "transcript_support_level": null,
          "aa_start": 492,
          "aa_end": null,
          "aa_length": 522,
          "cds_start": 1475,
          "cds_end": null,
          "cds_length": 1569,
          "cdna_start": 1674,
          "cdna_end": null,
          "cdna_length": 1784,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1475_1523delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg492fs",
          "transcript": "NM_001407071.1",
          "protein_id": "NP_001394000.1",
          "transcript_support_level": null,
          "aa_start": 492,
          "aa_end": null,
          "aa_length": 522,
          "cds_start": 1475,
          "cds_end": null,
          "cds_length": 1569,
          "cdna_start": 1767,
          "cdna_end": null,
          "cdna_length": 1877,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1475_1523delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg492fs",
          "transcript": "NM_001407078.1",
          "protein_id": "NP_001394007.1",
          "transcript_support_level": null,
          "aa_start": 492,
          "aa_end": null,
          "aa_length": 522,
          "cds_start": 1475,
          "cds_end": null,
          "cds_length": 1569,
          "cdna_start": 1824,
          "cdna_end": null,
          "cdna_length": 1934,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1475_1523delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg492fs",
          "transcript": "NM_001407086.1",
          "protein_id": "NP_001394015.1",
          "transcript_support_level": null,
          "aa_start": 492,
          "aa_end": null,
          "aa_length": 522,
          "cds_start": 1475,
          "cds_end": null,
          "cds_length": 1569,
          "cdna_start": 1601,
          "cdna_end": null,
          "cdna_length": 1711,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg491fs",
          "transcript": "NM_001048171.2",
          "protein_id": "NP_001041636.2",
          "transcript_support_level": null,
          "aa_start": 491,
          "aa_end": null,
          "aa_length": 521,
          "cds_start": 1472,
          "cds_end": null,
          "cds_length": 1566,
          "cdna_start": 1748,
          "cdna_end": null,
          "cdna_length": 1858,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg491fs",
          "transcript": "NM_001048173.2",
          "protein_id": "NP_001041638.1",
          "transcript_support_level": null,
          "aa_start": 491,
          "aa_end": null,
          "aa_length": 521,
          "cds_start": 1472,
          "cds_end": null,
          "cds_length": 1566,
          "cdna_start": 1671,
          "cdna_end": null,
          "cdna_length": 1781,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg491fs",
          "transcript": "NM_001293195.2",
          "protein_id": "NP_001280124.1",
          "transcript_support_level": null,
          "aa_start": 491,
          "aa_end": null,
          "aa_length": 521,
          "cds_start": 1472,
          "cds_end": null,
          "cds_length": 1566,
          "cdna_start": 1748,
          "cdna_end": null,
          "cdna_length": 1858,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg491fs",
          "transcript": "NM_001407070.1",
          "protein_id": "NP_001393999.1",
          "transcript_support_level": null,
          "aa_start": 491,
          "aa_end": null,
          "aa_length": 521,
          "cds_start": 1472,
          "cds_end": null,
          "cds_length": 1566,
          "cdna_start": 1764,
          "cdna_end": null,
          "cdna_length": 1874,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg491fs",
          "transcript": "NM_001407072.1",
          "protein_id": "NP_001394001.1",
          "transcript_support_level": null,
          "aa_start": 491,
          "aa_end": null,
          "aa_length": 521,
          "cds_start": 1472,
          "cds_end": null,
          "cds_length": 1566,
          "cdna_start": 1744,
          "cdna_end": null,
          "cdna_length": 1854,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 15,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg491fs",
          "transcript": "NM_001407073.1",
          "protein_id": "NP_001394002.1",
          "transcript_support_level": null,
          "aa_start": 491,
          "aa_end": null,
          "aa_length": 521,
          "cds_start": 1472,
          "cds_end": null,
          "cds_length": 1566,
          "cdna_start": 1706,
          "cdna_end": null,
          "cdna_length": 1816,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg491fs",
          "transcript": "NM_001407081.1",
          "protein_id": "NP_001394010.1",
          "transcript_support_level": null,
          "aa_start": 491,
          "aa_end": null,
          "aa_length": 521,
          "cds_start": 1472,
          "cds_end": null,
          "cds_length": 1566,
          "cdna_start": 1821,
          "cdna_end": null,
          "cdna_length": 1931,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg491fs",
          "transcript": "NM_001407088.1",
          "protein_id": "NP_001394017.1",
          "transcript_support_level": null,
          "aa_start": 491,
          "aa_end": null,
          "aa_length": 521,
          "cds_start": 1472,
          "cds_end": null,
          "cds_length": 1566,
          "cdna_start": 1739,
          "cdna_end": null,
          "cdna_length": 1849,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg491fs",
          "transcript": "NM_001407089.1",
          "protein_id": "NP_001394018.1",
          "transcript_support_level": null,
          "aa_start": 491,
          "aa_end": null,
          "aa_length": 521,
          "cds_start": 1472,
          "cds_end": null,
          "cds_length": 1566,
          "cdna_start": 1835,
          "cdna_end": null,
          "cdna_length": 1945,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg491fs",
          "transcript": "ENST00000672314.2",
          "protein_id": "ENSP00000500828.2",
          "transcript_support_level": null,
          "aa_start": 491,
          "aa_end": null,
          "aa_length": 521,
          "cds_start": 1472,
          "cds_end": null,
          "cds_length": 1566,
          "cdna_start": 2650,
          "cdna_end": null,
          "cdna_length": 2747,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg491fs",
          "transcript": "ENST00000713750.1",
          "protein_id": "ENSP00000519051.1",
          "transcript_support_level": null,
          "aa_start": 491,
          "aa_end": null,
          "aa_length": 521,
          "cds_start": 1472,
          "cds_end": null,
          "cds_length": 1566,
          "cdna_start": 1669,
          "cdna_end": null,
          "cdna_length": 1779,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 15,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1433_1481delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg478fs",
          "transcript": "NM_001407079.1",
          "protein_id": "NP_001394008.1",
          "transcript_support_level": null,
          "aa_start": 478,
          "aa_end": null,
          "aa_length": 508,
          "cds_start": 1433,
          "cds_end": null,
          "cds_length": 1527,
          "cdna_start": 1632,
          "cdna_end": null,
          "cdna_length": 1742,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 15,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1430_1478delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg477fs",
          "transcript": "NM_001407080.1",
          "protein_id": "NP_001394009.1",
          "transcript_support_level": null,
          "aa_start": 477,
          "aa_end": null,
          "aa_length": 507,
          "cds_start": 1430,
          "cds_end": null,
          "cds_length": 1524,
          "cdna_start": 1629,
          "cdna_end": null,
          "cdna_length": 1739,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1388_1436delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg463fs",
          "transcript": "NM_001407075.1",
          "protein_id": "NP_001394004.1",
          "transcript_support_level": null,
          "aa_start": 463,
          "aa_end": null,
          "aa_length": 493,
          "cds_start": 1388,
          "cds_end": null,
          "cds_length": 1482,
          "cdna_start": 1743,
          "cdna_end": null,
          "cdna_length": 1853,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 15,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1325_1373delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg442fs",
          "transcript": "ENST00000529892.6",
          "protein_id": "ENSP00000432528.2",
          "transcript_support_level": 5,
          "aa_start": 442,
          "aa_end": null,
          "aa_length": 472,
          "cds_start": 1325,
          "cds_end": null,
          "cds_length": 1419,
          "cdna_start": 1534,
          "cdna_end": null,
          "cdna_length": 1638,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1196_1244delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg399fs",
          "transcript": "NM_001293192.2",
          "protein_id": "NP_001280121.1",
          "transcript_support_level": null,
          "aa_start": 399,
          "aa_end": null,
          "aa_length": 429,
          "cds_start": 1196,
          "cds_end": null,
          "cds_length": 1290,
          "cdna_start": 1684,
          "cdna_end": null,
          "cdna_length": 1794,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1196_1244delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg399fs",
          "transcript": "NM_001293196.2",
          "protein_id": "NP_001280125.1",
          "transcript_support_level": null,
          "aa_start": 399,
          "aa_end": null,
          "aa_length": 429,
          "cds_start": 1196,
          "cds_end": null,
          "cds_length": 1290,
          "cdna_start": 1607,
          "cdna_end": null,
          "cdna_length": 1717,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1196_1244delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg399fs",
          "transcript": "NM_001407091.1",
          "protein_id": "NP_001394020.1",
          "transcript_support_level": null,
          "aa_start": 399,
          "aa_end": null,
          "aa_length": 429,
          "cds_start": 1196,
          "cds_end": null,
          "cds_length": 1290,
          "cdna_start": 1534,
          "cdna_end": null,
          "cdna_length": 1644,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 15,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1127_1175delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg376fs",
          "transcript": "NM_001350650.2",
          "protein_id": "NP_001337579.1",
          "transcript_support_level": null,
          "aa_start": 376,
          "aa_end": null,
          "aa_length": 406,
          "cds_start": 1127,
          "cds_end": null,
          "cds_length": 1221,
          "cdna_start": 1674,
          "cdna_end": null,
          "cdna_length": 1784,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 15,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1127_1175delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg376fs",
          "transcript": "NM_001350651.2",
          "protein_id": "NP_001337580.1",
          "transcript_support_level": null,
          "aa_start": 376,
          "aa_end": null,
          "aa_length": 406,
          "cds_start": 1127,
          "cds_end": null,
          "cds_length": 1221,
          "cdna_start": 1610,
          "cdna_end": null,
          "cdna_length": 1720,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 15,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1127_1175delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg376fs",
          "transcript": "NM_001407082.1",
          "protein_id": "NP_001394011.1",
          "transcript_support_level": null,
          "aa_start": 376,
          "aa_end": null,
          "aa_length": 406,
          "cds_start": 1127,
          "cds_end": null,
          "cds_length": 1221,
          "cdna_start": 1533,
          "cdna_end": null,
          "cdna_length": 1643,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 11,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1088_1136delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg363fs",
          "transcript": "ENST00000412971.6",
          "protein_id": "ENSP00000410263.2",
          "transcript_support_level": 3,
          "aa_start": 363,
          "aa_end": null,
          "aa_length": 393,
          "cds_start": 1088,
          "cds_end": null,
          "cds_length": 1182,
          "cdna_start": 1263,
          "cdna_end": null,
          "cdna_length": 1373,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.599_647delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg200fs",
          "transcript": "ENST00000529984.6",
          "protein_id": "ENSP00000437093.2",
          "transcript_support_level": 2,
          "aa_start": 200,
          "aa_end": null,
          "aa_length": 230,
          "cds_start": 599,
          "cds_end": null,
          "cds_length": 693,
          "cdna_start": 840,
          "cdna_end": null,
          "cdna_length": 1029,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.557_605delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg186fs",
          "transcript": "ENST00000488731.6",
          "protein_id": "ENSP00000432330.1",
          "transcript_support_level": 5,
          "aa_start": 186,
          "aa_end": null,
          "aa_length": 216,
          "cds_start": 557,
          "cds_end": null,
          "cds_length": 651,
          "cdna_start": 631,
          "cdna_end": null,
          "cdna_length": 740,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1532_1580delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg511fs",
          "transcript": "XM_011541497.4",
          "protein_id": "XP_011539799.1",
          "transcript_support_level": null,
          "aa_start": 511,
          "aa_end": null,
          "aa_length": 541,
          "cds_start": 1532,
          "cds_end": null,
          "cds_length": 1626,
          "cdna_start": 1880,
          "cdna_end": null,
          "cdna_length": 1990,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1523_1571delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg508fs",
          "transcript": "XM_047421191.1",
          "protein_id": "XP_047277147.1",
          "transcript_support_level": null,
          "aa_start": 508,
          "aa_end": null,
          "aa_length": 538,
          "cds_start": 1523,
          "cds_end": null,
          "cds_length": 1617,
          "cdna_start": 2175,
          "cdna_end": null,
          "cdna_length": 2285,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1523_1571delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg508fs",
          "transcript": "XM_047421192.1",
          "protein_id": "XP_047277148.1",
          "transcript_support_level": null,
          "aa_start": 508,
          "aa_end": null,
          "aa_length": 538,
          "cds_start": 1523,
          "cds_end": null,
          "cds_length": 1617,
          "cdna_start": 2102,
          "cdna_end": null,
          "cdna_length": 2212,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1523_1571delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg508fs",
          "transcript": "XM_047421193.1",
          "protein_id": "XP_047277149.1",
          "transcript_support_level": null,
          "aa_start": 508,
          "aa_end": null,
          "aa_length": 538,
          "cds_start": 1523,
          "cds_end": null,
          "cds_length": 1617,
          "cdna_start": 2339,
          "cdna_end": null,
          "cdna_length": 2449,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1514_1562delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg505fs",
          "transcript": "XM_011541502.3",
          "protein_id": "XP_011539804.1",
          "transcript_support_level": null,
          "aa_start": 505,
          "aa_end": null,
          "aa_length": 535,
          "cds_start": 1514,
          "cds_end": null,
          "cds_length": 1608,
          "cdna_start": 1877,
          "cdna_end": null,
          "cdna_length": 1987,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 15,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1514_1562delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg505fs",
          "transcript": "XM_011541503.3",
          "protein_id": "XP_011539805.1",
          "transcript_support_level": null,
          "aa_start": 505,
          "aa_end": null,
          "aa_length": 535,
          "cds_start": 1514,
          "cds_end": null,
          "cds_length": 1608,
          "cdna_start": 1748,
          "cdna_end": null,
          "cdna_length": 1858,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1514_1562delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg505fs",
          "transcript": "XM_017001332.2",
          "protein_id": "XP_016856821.1",
          "transcript_support_level": null,
          "aa_start": 505,
          "aa_end": null,
          "aa_length": 535,
          "cds_start": 1514,
          "cds_end": null,
          "cds_length": 1608,
          "cdna_start": 1786,
          "cdna_end": null,
          "cdna_length": 1896,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1514_1562delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg505fs",
          "transcript": "XM_017001333.2",
          "protein_id": "XP_016856822.1",
          "transcript_support_level": null,
          "aa_start": 505,
          "aa_end": null,
          "aa_length": 535,
          "cds_start": 1514,
          "cds_end": null,
          "cds_length": 1608,
          "cdna_start": 1781,
          "cdna_end": null,
          "cdna_length": 1891,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1514_1562delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg505fs",
          "transcript": "XM_047421194.1",
          "protein_id": "XP_047277150.1",
          "transcript_support_level": null,
          "aa_start": 505,
          "aa_end": null,
          "aa_length": 535,
          "cds_start": 1514,
          "cds_end": null,
          "cds_length": 1608,
          "cdna_start": 1863,
          "cdna_end": null,
          "cdna_length": 1973,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1490_1538delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg497fs",
          "transcript": "XM_047421197.1",
          "protein_id": "XP_047277153.1",
          "transcript_support_level": null,
          "aa_start": 497,
          "aa_end": null,
          "aa_length": 527,
          "cds_start": 1490,
          "cds_end": null,
          "cds_length": 1584,
          "cdna_start": 3311,
          "cdna_end": null,
          "cdna_length": 3421,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1490_1538delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg497fs",
          "transcript": "XM_047421198.1",
          "protein_id": "XP_047277154.1",
          "transcript_support_level": null,
          "aa_start": 497,
          "aa_end": null,
          "aa_length": 527,
          "cds_start": 1490,
          "cds_end": null,
          "cds_length": 1584,
          "cdna_start": 2069,
          "cdna_end": null,
          "cdna_length": 2179,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1481_1529delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg494fs",
          "transcript": "XM_047421199.1",
          "protein_id": "XP_047277155.1",
          "transcript_support_level": null,
          "aa_start": 494,
          "aa_end": null,
          "aa_length": 524,
          "cds_start": 1481,
          "cds_end": null,
          "cds_length": 1575,
          "cdna_start": 2133,
          "cdna_end": null,
          "cdna_length": 2243,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 15,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1430_1478delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg477fs",
          "transcript": "XM_047421201.1",
          "protein_id": "XP_047277157.1",
          "transcript_support_level": null,
          "aa_start": 477,
          "aa_end": null,
          "aa_length": 507,
          "cds_start": 1430,
          "cds_end": null,
          "cds_length": 1524,
          "cdna_start": 1556,
          "cdna_end": null,
          "cdna_length": 1666,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 11,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1094_1142delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg365fs",
          "transcript": "XM_047421203.1",
          "protein_id": "XP_047277159.1",
          "transcript_support_level": null,
          "aa_start": 365,
          "aa_end": null,
          "aa_length": 395,
          "cds_start": 1094,
          "cds_end": null,
          "cds_length": 1188,
          "cdna_start": 1221,
          "cdna_end": null,
          "cdna_length": 1331,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RKKPRMGQQVLDNFFRS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 13,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.1085_1133delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg362fs",
          "transcript": "XM_047421204.1",
          "protein_id": "XP_047277160.1",
          "transcript_support_level": null,
          "aa_start": 362,
          "aa_end": null,
          "aa_length": 392,
          "cds_start": 1085,
          "cds_end": null,
          "cds_length": 1179,
          "cdna_start": 1315,
          "cdna_end": null,
          "cdna_length": 1425,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "SEKAPHGPASPG*",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant",
            "stop_lost"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 3,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.153_*12delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Ser51fs",
          "transcript": "ENST00000531105.5",
          "protein_id": "ENSP00000431292.1",
          "transcript_support_level": 5,
          "aa_start": 51,
          "aa_end": null,
          "aa_length": 62,
          "cds_start": 153,
          "cds_end": null,
          "cds_length": 189,
          "cdna_start": 395,
          "cdna_end": null,
          "cdna_length": 501,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.*334_*382delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "ENST00000467459.6",
          "protein_id": "ENSP00000435889.2",
          "transcript_support_level": 3,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1731,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.793_841delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "ENST00000482094.5",
          "protein_id": null,
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 920,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.*215_*263delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "ENST00000485271.6",
          "protein_id": "ENSP00000431264.2",
          "transcript_support_level": 3,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1862,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 10,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.*801_*849delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "ENST00000533178.6",
          "protein_id": "ENSP00000436430.2",
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1225,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 15,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.*801_*849delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "ENST00000672011.1",
          "protein_id": "ENSP00000500418.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2209,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 14,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.*1562_*1610delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "ENST00000713749.1",
          "protein_id": "ENSP00000519050.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2049,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.1880_1928delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "NR_146882.2",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2038,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.1729_1777delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "NR_146883.2",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1887,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.1876_1924delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "NR_176269.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2034,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.1739_1787delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "NR_176271.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1897,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.1803_1851delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "NR_176272.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1961,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.1761_1809delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "NR_176273.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1919,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.1816_1864delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "NR_176274.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1974,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 3,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "c.153_*12delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "ENST00000531105.5",
          "protein_id": "ENSP00000431292.1",
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 62,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 189,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 501,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.*334_*382delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "ENST00000467459.6",
          "protein_id": "ENSP00000435889.2",
          "transcript_support_level": 3,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1731,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.*215_*263delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "ENST00000485271.6",
          "protein_id": "ENSP00000431264.2",
          "transcript_support_level": 3,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1862,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 10,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.*801_*849delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "ENST00000533178.6",
          "protein_id": "ENSP00000436430.2",
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1225,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 15,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.*801_*849delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "ENST00000672011.1",
          "protein_id": "ENSP00000500418.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2209,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 14,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MUTYH",
          "gene_hgnc_id": 7527,
          "hgvs_c": "n.*1562_*1610delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null,
          "transcript": "ENST00000713749.1",
          "protein_id": "ENSP00000519050.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2049,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "MUTYH",
      "gene_hgnc_id": 7527,
      "dbsnp": "rs1064794411",
      "frequency_reference_population": null,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 0,
      "gnomad_exomes_af": null,
      "gnomad_genomes_af": null,
      "gnomad_exomes_ac": null,
      "gnomad_genomes_ac": null,
      "gnomad_exomes_homalt": null,
      "gnomad_genomes_homalt": null,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 3.586,
      "phylop100way_prediction": "Benign",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 4,
      "acmg_classification": "Uncertain_significance",
      "acmg_criteria": "PVS1_Strong",
      "acmg_by_gene": [
        {
          "score": 4,
          "benign_score": 0,
          "pathogenic_score": 4,
          "criteria": [
            "PVS1_Strong"
          ],
          "verdict": "Uncertain_significance",
          "transcript": "ENST00000456914.7",
          "gene_symbol": "MUTYH",
          "hgnc_id": 7527,
          "effects": [
            "frameshift_variant"
          ],
          "inheritance_mode": "AD,AR",
          "hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": "p.Arg491fs"
        },
        {
          "score": 0,
          "benign_score": 0,
          "pathogenic_score": 0,
          "criteria": [],
          "verdict": "Uncertain_significance",
          "transcript": "ENST00000671898.1",
          "gene_symbol": "ENSG00000288208",
          "hgnc_id": null,
          "effects": [
            "non_coding_transcript_exon_variant"
          ],
          "inheritance_mode": "",
          "hgvs_c": "n.*215_*263delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
          "hgvs_p": null
        }
      ],
      "clinvar_disease": "Familial adenomatous polyposis 2,Hereditary cancer-predisposing syndrome,not provided",
      "clinvar_classification": "Uncertain significance",
      "clinvar_review_status": "criteria provided, multiple submitters, no conflicts",
      "clinvar_submissions_summary": "US:3",
      "phenotype_combined": "not provided|Familial adenomatous polyposis 2|Hereditary cancer-predisposing syndrome",
      "pathogenicity_classification_combined": "Uncertain significance",
      "custom_annotations": null
    }
  ],
  "message": null
}