← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 1-45329351-AGACCGAAAGAAATTATCCAGGACTTGCTGGCCCATGCGGGGCTTTTTCC-A (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=1&pos=45329351&ref=AGACCGAAAGAAATTATCCAGGACTTGCTGGCCCATGCGGGGCTTTTTCC&alt=A&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "1",
"pos": 45329351,
"ref": "AGACCGAAAGAAATTATCCAGGACTTGCTGGCCCATGCGGGGCTTTTTCC",
"alt": "A",
"effect": "frameshift_variant",
"transcript": "ENST00000456914.7",
"consequences": [
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1556_1604delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg519fs",
"transcript": "NM_001128425.2",
"protein_id": "NP_001121897.1",
"transcript_support_level": null,
"aa_start": 519,
"aa_end": null,
"aa_length": 549,
"cds_start": 1556,
"cds_end": null,
"cds_length": 1650,
"cdna_start": 1790,
"cdna_end": null,
"cdna_length": 1900,
"mane_select": null,
"mane_plus": "ENST00000710952.2",
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1556_1604delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg519fs",
"transcript": "ENST00000710952.2",
"protein_id": "ENSP00000518552.2",
"transcript_support_level": null,
"aa_start": 519,
"aa_end": null,
"aa_length": 549,
"cds_start": 1556,
"cds_end": null,
"cds_length": 1650,
"cdna_start": 1790,
"cdna_end": null,
"cdna_length": 1900,
"mane_select": null,
"mane_plus": "NM_001128425.2",
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg491fs",
"transcript": "NM_001048174.2",
"protein_id": "NP_001041639.1",
"transcript_support_level": null,
"aa_start": 491,
"aa_end": null,
"aa_length": 521,
"cds_start": 1472,
"cds_end": null,
"cds_length": 1566,
"cdna_start": 1598,
"cdna_end": null,
"cdna_length": 1708,
"mane_select": "ENST00000456914.7",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg491fs",
"transcript": "ENST00000456914.7",
"protein_id": "ENSP00000407590.2",
"transcript_support_level": 1,
"aa_start": 491,
"aa_end": null,
"aa_length": 521,
"cds_start": 1472,
"cds_end": null,
"cds_length": 1566,
"cdna_start": 1598,
"cdna_end": null,
"cdna_length": 1708,
"mane_select": "NM_001048174.2",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1547_1595delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg516fs",
"transcript": "ENST00000372098.7",
"protein_id": "ENSP00000361170.3",
"transcript_support_level": 1,
"aa_start": 516,
"aa_end": null,
"aa_length": 546,
"cds_start": 1547,
"cds_end": null,
"cds_length": 1641,
"cdna_start": 1729,
"cdna_end": null,
"cdna_length": 1839,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1517_1565delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg506fs",
"transcript": "ENST00000372110.7",
"protein_id": "ENSP00000361182.3",
"transcript_support_level": 1,
"aa_start": 506,
"aa_end": null,
"aa_length": 536,
"cds_start": 1517,
"cds_end": null,
"cds_length": 1611,
"cdna_start": 1699,
"cdna_end": null,
"cdna_length": 1809,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1514_1562delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg505fs",
"transcript": "ENST00000372115.7",
"protein_id": "ENSP00000361187.3",
"transcript_support_level": 1,
"aa_start": 505,
"aa_end": null,
"aa_length": 535,
"cds_start": 1514,
"cds_end": null,
"cds_length": 1608,
"cdna_start": 1778,
"cdna_end": null,
"cdna_length": 1888,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1505_1553delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg502fs",
"transcript": "ENST00000448481.5",
"protein_id": "ENSP00000409718.1",
"transcript_support_level": 1,
"aa_start": 502,
"aa_end": null,
"aa_length": 532,
"cds_start": 1505,
"cds_end": null,
"cds_length": 1599,
"cdna_start": 1596,
"cdna_end": null,
"cdna_length": 1706,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1475_1523delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg492fs",
"transcript": "ENST00000354383.10",
"protein_id": "ENSP00000346354.6",
"transcript_support_level": 1,
"aa_start": 492,
"aa_end": null,
"aa_length": 522,
"cds_start": 1475,
"cds_end": null,
"cds_length": 1569,
"cdna_start": 1634,
"cdna_end": null,
"cdna_length": 1744,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg491fs",
"transcript": "ENST00000355498.6",
"protein_id": "ENSP00000347685.2",
"transcript_support_level": 1,
"aa_start": 491,
"aa_end": null,
"aa_length": 521,
"cds_start": 1472,
"cds_end": null,
"cds_length": 1566,
"cdna_start": 1666,
"cdna_end": null,
"cdna_length": 1776,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 17,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg491fs",
"transcript": "ENST00000372104.5",
"protein_id": "ENSP00000361176.1",
"transcript_support_level": 1,
"aa_start": 491,
"aa_end": null,
"aa_length": 521,
"cds_start": 1472,
"cds_end": null,
"cds_length": 1566,
"cdna_start": 1713,
"cdna_end": null,
"cdna_length": 1823,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.*1285_*1333delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "ENST00000475516.5",
"protein_id": "ENSP00000433843.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1677,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.*1285_*1333delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "ENST00000481571.5",
"protein_id": "ENSP00000436597.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1742,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 21,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ENSG00000288208",
"gene_hgnc_id": null,
"hgvs_c": "n.*215_*263delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "ENST00000671898.1",
"protein_id": "ENSP00000499896.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2768,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.*1285_*1333delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "ENST00000475516.5",
"protein_id": "ENSP00000433843.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1677,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.*1285_*1333delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "ENST00000481571.5",
"protein_id": "ENSP00000436597.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1742,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 21,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ENSG00000288208",
"gene_hgnc_id": null,
"hgvs_c": "n.*215_*263delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "ENST00000671898.1",
"protein_id": "ENSP00000499896.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2768,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1547_1595delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg516fs",
"transcript": "NM_012222.3",
"protein_id": "NP_036354.1",
"transcript_support_level": null,
"aa_start": 516,
"aa_end": null,
"aa_length": 546,
"cds_start": 1547,
"cds_end": null,
"cds_length": 1641,
"cdna_start": 1781,
"cdna_end": null,
"cdna_length": 1891,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1547_1595delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg516fs",
"transcript": "ENST00000672818.3",
"protein_id": "ENSP00000500891.1",
"transcript_support_level": null,
"aa_start": 516,
"aa_end": null,
"aa_length": 546,
"cds_start": 1547,
"cds_end": null,
"cds_length": 1641,
"cdna_start": 1781,
"cdna_end": null,
"cdna_length": 1891,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1517_1565delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg506fs",
"transcript": "NM_001293190.2",
"protein_id": "NP_001280119.1",
"transcript_support_level": null,
"aa_start": 506,
"aa_end": null,
"aa_length": 536,
"cds_start": 1517,
"cds_end": null,
"cds_length": 1611,
"cdna_start": 1751,
"cdna_end": null,
"cdna_length": 1861,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1514_1562delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg505fs",
"transcript": "NM_001407083.1",
"protein_id": "NP_001394012.1",
"transcript_support_level": null,
"aa_start": 505,
"aa_end": null,
"aa_length": 535,
"cds_start": 1514,
"cds_end": null,
"cds_length": 1608,
"cdna_start": 1713,
"cdna_end": null,
"cdna_length": 1823,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1514_1562delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg505fs",
"transcript": "NM_001407085.1",
"protein_id": "NP_001394014.1",
"transcript_support_level": null,
"aa_start": 505,
"aa_end": null,
"aa_length": 535,
"cds_start": 1514,
"cds_end": null,
"cds_length": 1608,
"cdna_start": 1640,
"cdna_end": null,
"cdna_length": 1750,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1514_1562delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg505fs",
"transcript": "ENST00000528013.6",
"protein_id": "ENSP00000433130.2",
"transcript_support_level": 5,
"aa_start": 505,
"aa_end": null,
"aa_length": 535,
"cds_start": 1514,
"cds_end": null,
"cds_length": 1608,
"cdna_start": 1616,
"cdna_end": null,
"cdna_length": 1662,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1505_1553delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg502fs",
"transcript": "NM_001293191.2",
"protein_id": "NP_001280120.1",
"transcript_support_level": null,
"aa_start": 502,
"aa_end": null,
"aa_length": 532,
"cds_start": 1505,
"cds_end": null,
"cds_length": 1599,
"cdna_start": 1631,
"cdna_end": null,
"cdna_length": 1741,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 15,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1505_1553delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg502fs",
"transcript": "NM_001407069.1",
"protein_id": "NP_001393998.1",
"transcript_support_level": null,
"aa_start": 502,
"aa_end": null,
"aa_length": 532,
"cds_start": 1505,
"cds_end": null,
"cds_length": 1599,
"cdna_start": 1739,
"cdna_end": null,
"cdna_length": 1849,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1505_1553delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg502fs",
"transcript": "NM_001407077.1",
"protein_id": "NP_001394006.1",
"transcript_support_level": null,
"aa_start": 502,
"aa_end": null,
"aa_length": 532,
"cds_start": 1505,
"cds_end": null,
"cds_length": 1599,
"cdna_start": 1704,
"cdna_end": null,
"cdna_length": 1814,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1505_1553delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg502fs",
"transcript": "ENST00000435155.2",
"protein_id": "ENSP00000403655.2",
"transcript_support_level": 5,
"aa_start": 502,
"aa_end": null,
"aa_length": 532,
"cds_start": 1505,
"cds_end": null,
"cds_length": 1599,
"cdna_start": 1704,
"cdna_end": null,
"cdna_length": 1801,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 17,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1493_1541delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg498fs",
"transcript": "NM_001407087.1",
"protein_id": "NP_001394016.1",
"transcript_support_level": null,
"aa_start": 498,
"aa_end": null,
"aa_length": 528,
"cds_start": 1493,
"cds_end": null,
"cds_length": 1587,
"cdna_start": 2072,
"cdna_end": null,
"cdna_length": 2182,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 18,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1493_1541delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg498fs",
"transcript": "ENST00000713751.1",
"protein_id": "ENSP00000519052.1",
"transcript_support_level": null,
"aa_start": 498,
"aa_end": null,
"aa_length": 528,
"cds_start": 1493,
"cds_end": null,
"cds_length": 1587,
"cdna_start": 1834,
"cdna_end": null,
"cdna_length": 1942,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 17,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1490_1538delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg497fs",
"transcript": "ENST00000483127.2",
"protein_id": "ENSP00000436469.2",
"transcript_support_level": 5,
"aa_start": 497,
"aa_end": null,
"aa_length": 527,
"cds_start": 1490,
"cds_end": null,
"cds_length": 1584,
"cdna_start": 2044,
"cdna_end": null,
"cdna_length": 2154,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1475_1523delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg492fs",
"transcript": "NM_001048172.2",
"protein_id": "NP_001041637.1",
"transcript_support_level": null,
"aa_start": 492,
"aa_end": null,
"aa_length": 522,
"cds_start": 1475,
"cds_end": null,
"cds_length": 1569,
"cdna_start": 1674,
"cdna_end": null,
"cdna_length": 1784,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1475_1523delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg492fs",
"transcript": "NM_001407071.1",
"protein_id": "NP_001394000.1",
"transcript_support_level": null,
"aa_start": 492,
"aa_end": null,
"aa_length": 522,
"cds_start": 1475,
"cds_end": null,
"cds_length": 1569,
"cdna_start": 1767,
"cdna_end": null,
"cdna_length": 1877,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 17,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1475_1523delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg492fs",
"transcript": "NM_001407078.1",
"protein_id": "NP_001394007.1",
"transcript_support_level": null,
"aa_start": 492,
"aa_end": null,
"aa_length": 522,
"cds_start": 1475,
"cds_end": null,
"cds_length": 1569,
"cdna_start": 1824,
"cdna_end": null,
"cdna_length": 1934,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1475_1523delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg492fs",
"transcript": "NM_001407086.1",
"protein_id": "NP_001394015.1",
"transcript_support_level": null,
"aa_start": 492,
"aa_end": null,
"aa_length": 522,
"cds_start": 1475,
"cds_end": null,
"cds_length": 1569,
"cdna_start": 1601,
"cdna_end": null,
"cdna_length": 1711,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg491fs",
"transcript": "NM_001048171.2",
"protein_id": "NP_001041636.2",
"transcript_support_level": null,
"aa_start": 491,
"aa_end": null,
"aa_length": 521,
"cds_start": 1472,
"cds_end": null,
"cds_length": 1566,
"cdna_start": 1748,
"cdna_end": null,
"cdna_length": 1858,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg491fs",
"transcript": "NM_001048173.2",
"protein_id": "NP_001041638.1",
"transcript_support_level": null,
"aa_start": 491,
"aa_end": null,
"aa_length": 521,
"cds_start": 1472,
"cds_end": null,
"cds_length": 1566,
"cdna_start": 1671,
"cdna_end": null,
"cdna_length": 1781,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 17,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg491fs",
"transcript": "NM_001293195.2",
"protein_id": "NP_001280124.1",
"transcript_support_level": null,
"aa_start": 491,
"aa_end": null,
"aa_length": 521,
"cds_start": 1472,
"cds_end": null,
"cds_length": 1566,
"cdna_start": 1748,
"cdna_end": null,
"cdna_length": 1858,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg491fs",
"transcript": "NM_001407070.1",
"protein_id": "NP_001393999.1",
"transcript_support_level": null,
"aa_start": 491,
"aa_end": null,
"aa_length": 521,
"cds_start": 1472,
"cds_end": null,
"cds_length": 1566,
"cdna_start": 1764,
"cdna_end": null,
"cdna_length": 1874,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg491fs",
"transcript": "NM_001407072.1",
"protein_id": "NP_001394001.1",
"transcript_support_level": null,
"aa_start": 491,
"aa_end": null,
"aa_length": 521,
"cds_start": 1472,
"cds_end": null,
"cds_length": 1566,
"cdna_start": 1744,
"cdna_end": null,
"cdna_length": 1854,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 15,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg491fs",
"transcript": "NM_001407073.1",
"protein_id": "NP_001394002.1",
"transcript_support_level": null,
"aa_start": 491,
"aa_end": null,
"aa_length": 521,
"cds_start": 1472,
"cds_end": null,
"cds_length": 1566,
"cdna_start": 1706,
"cdna_end": null,
"cdna_length": 1816,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 17,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg491fs",
"transcript": "NM_001407081.1",
"protein_id": "NP_001394010.1",
"transcript_support_level": null,
"aa_start": 491,
"aa_end": null,
"aa_length": 521,
"cds_start": 1472,
"cds_end": null,
"cds_length": 1566,
"cdna_start": 1821,
"cdna_end": null,
"cdna_length": 1931,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 17,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg491fs",
"transcript": "NM_001407088.1",
"protein_id": "NP_001394017.1",
"transcript_support_level": null,
"aa_start": 491,
"aa_end": null,
"aa_length": 521,
"cds_start": 1472,
"cds_end": null,
"cds_length": 1566,
"cdna_start": 1739,
"cdna_end": null,
"cdna_length": 1849,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg491fs",
"transcript": "NM_001407089.1",
"protein_id": "NP_001394018.1",
"transcript_support_level": null,
"aa_start": 491,
"aa_end": null,
"aa_length": 521,
"cds_start": 1472,
"cds_end": null,
"cds_length": 1566,
"cdna_start": 1835,
"cdna_end": null,
"cdna_length": 1945,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg491fs",
"transcript": "ENST00000672314.2",
"protein_id": "ENSP00000500828.2",
"transcript_support_level": null,
"aa_start": 491,
"aa_end": null,
"aa_length": 521,
"cds_start": 1472,
"cds_end": null,
"cds_length": 1566,
"cdna_start": 2650,
"cdna_end": null,
"cdna_length": 2747,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg491fs",
"transcript": "ENST00000713750.1",
"protein_id": "ENSP00000519051.1",
"transcript_support_level": null,
"aa_start": 491,
"aa_end": null,
"aa_length": 521,
"cds_start": 1472,
"cds_end": null,
"cds_length": 1566,
"cdna_start": 1669,
"cdna_end": null,
"cdna_length": 1779,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 15,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1433_1481delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg478fs",
"transcript": "NM_001407079.1",
"protein_id": "NP_001394008.1",
"transcript_support_level": null,
"aa_start": 478,
"aa_end": null,
"aa_length": 508,
"cds_start": 1433,
"cds_end": null,
"cds_length": 1527,
"cdna_start": 1632,
"cdna_end": null,
"cdna_length": 1742,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 15,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1430_1478delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg477fs",
"transcript": "NM_001407080.1",
"protein_id": "NP_001394009.1",
"transcript_support_level": null,
"aa_start": 477,
"aa_end": null,
"aa_length": 507,
"cds_start": 1430,
"cds_end": null,
"cds_length": 1524,
"cdna_start": 1629,
"cdna_end": null,
"cdna_length": 1739,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1388_1436delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg463fs",
"transcript": "NM_001407075.1",
"protein_id": "NP_001394004.1",
"transcript_support_level": null,
"aa_start": 463,
"aa_end": null,
"aa_length": 493,
"cds_start": 1388,
"cds_end": null,
"cds_length": 1482,
"cdna_start": 1743,
"cdna_end": null,
"cdna_length": 1853,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 15,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1325_1373delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg442fs",
"transcript": "ENST00000529892.6",
"protein_id": "ENSP00000432528.2",
"transcript_support_level": 5,
"aa_start": 442,
"aa_end": null,
"aa_length": 472,
"cds_start": 1325,
"cds_end": null,
"cds_length": 1419,
"cdna_start": 1534,
"cdna_end": null,
"cdna_length": 1638,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1196_1244delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg399fs",
"transcript": "NM_001293192.2",
"protein_id": "NP_001280121.1",
"transcript_support_level": null,
"aa_start": 399,
"aa_end": null,
"aa_length": 429,
"cds_start": 1196,
"cds_end": null,
"cds_length": 1290,
"cdna_start": 1684,
"cdna_end": null,
"cdna_length": 1794,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1196_1244delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg399fs",
"transcript": "NM_001293196.2",
"protein_id": "NP_001280125.1",
"transcript_support_level": null,
"aa_start": 399,
"aa_end": null,
"aa_length": 429,
"cds_start": 1196,
"cds_end": null,
"cds_length": 1290,
"cdna_start": 1607,
"cdna_end": null,
"cdna_length": 1717,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1196_1244delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg399fs",
"transcript": "NM_001407091.1",
"protein_id": "NP_001394020.1",
"transcript_support_level": null,
"aa_start": 399,
"aa_end": null,
"aa_length": 429,
"cds_start": 1196,
"cds_end": null,
"cds_length": 1290,
"cdna_start": 1534,
"cdna_end": null,
"cdna_length": 1644,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 15,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1127_1175delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg376fs",
"transcript": "NM_001350650.2",
"protein_id": "NP_001337579.1",
"transcript_support_level": null,
"aa_start": 376,
"aa_end": null,
"aa_length": 406,
"cds_start": 1127,
"cds_end": null,
"cds_length": 1221,
"cdna_start": 1674,
"cdna_end": null,
"cdna_length": 1784,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 15,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1127_1175delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg376fs",
"transcript": "NM_001350651.2",
"protein_id": "NP_001337580.1",
"transcript_support_level": null,
"aa_start": 376,
"aa_end": null,
"aa_length": 406,
"cds_start": 1127,
"cds_end": null,
"cds_length": 1221,
"cdna_start": 1610,
"cdna_end": null,
"cdna_length": 1720,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 15,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1127_1175delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg376fs",
"transcript": "NM_001407082.1",
"protein_id": "NP_001394011.1",
"transcript_support_level": null,
"aa_start": 376,
"aa_end": null,
"aa_length": 406,
"cds_start": 1127,
"cds_end": null,
"cds_length": 1221,
"cdna_start": 1533,
"cdna_end": null,
"cdna_length": 1643,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1088_1136delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg363fs",
"transcript": "ENST00000412971.6",
"protein_id": "ENSP00000410263.2",
"transcript_support_level": 3,
"aa_start": 363,
"aa_end": null,
"aa_length": 393,
"cds_start": 1088,
"cds_end": null,
"cds_length": 1182,
"cdna_start": 1263,
"cdna_end": null,
"cdna_length": 1373,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.599_647delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg200fs",
"transcript": "ENST00000529984.6",
"protein_id": "ENSP00000437093.2",
"transcript_support_level": 2,
"aa_start": 200,
"aa_end": null,
"aa_length": 230,
"cds_start": 599,
"cds_end": null,
"cds_length": 693,
"cdna_start": 840,
"cdna_end": null,
"cdna_length": 1029,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.557_605delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg186fs",
"transcript": "ENST00000488731.6",
"protein_id": "ENSP00000432330.1",
"transcript_support_level": 5,
"aa_start": 186,
"aa_end": null,
"aa_length": 216,
"cds_start": 557,
"cds_end": null,
"cds_length": 651,
"cdna_start": 631,
"cdna_end": null,
"cdna_length": 740,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1532_1580delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg511fs",
"transcript": "XM_011541497.4",
"protein_id": "XP_011539799.1",
"transcript_support_level": null,
"aa_start": 511,
"aa_end": null,
"aa_length": 541,
"cds_start": 1532,
"cds_end": null,
"cds_length": 1626,
"cdna_start": 1880,
"cdna_end": null,
"cdna_length": 1990,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 17,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1523_1571delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg508fs",
"transcript": "XM_047421191.1",
"protein_id": "XP_047277147.1",
"transcript_support_level": null,
"aa_start": 508,
"aa_end": null,
"aa_length": 538,
"cds_start": 1523,
"cds_end": null,
"cds_length": 1617,
"cdna_start": 2175,
"cdna_end": null,
"cdna_length": 2285,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 17,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1523_1571delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg508fs",
"transcript": "XM_047421192.1",
"protein_id": "XP_047277148.1",
"transcript_support_level": null,
"aa_start": 508,
"aa_end": null,
"aa_length": 538,
"cds_start": 1523,
"cds_end": null,
"cds_length": 1617,
"cdna_start": 2102,
"cdna_end": null,
"cdna_length": 2212,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 17,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1523_1571delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg508fs",
"transcript": "XM_047421193.1",
"protein_id": "XP_047277149.1",
"transcript_support_level": null,
"aa_start": 508,
"aa_end": null,
"aa_length": 538,
"cds_start": 1523,
"cds_end": null,
"cds_length": 1617,
"cdna_start": 2339,
"cdna_end": null,
"cdna_length": 2449,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1514_1562delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg505fs",
"transcript": "XM_011541502.3",
"protein_id": "XP_011539804.1",
"transcript_support_level": null,
"aa_start": 505,
"aa_end": null,
"aa_length": 535,
"cds_start": 1514,
"cds_end": null,
"cds_length": 1608,
"cdna_start": 1877,
"cdna_end": null,
"cdna_length": 1987,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 15,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1514_1562delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg505fs",
"transcript": "XM_011541503.3",
"protein_id": "XP_011539805.1",
"transcript_support_level": null,
"aa_start": 505,
"aa_end": null,
"aa_length": 535,
"cds_start": 1514,
"cds_end": null,
"cds_length": 1608,
"cdna_start": 1748,
"cdna_end": null,
"cdna_length": 1858,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1514_1562delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg505fs",
"transcript": "XM_017001332.2",
"protein_id": "XP_016856821.1",
"transcript_support_level": null,
"aa_start": 505,
"aa_end": null,
"aa_length": 535,
"cds_start": 1514,
"cds_end": null,
"cds_length": 1608,
"cdna_start": 1786,
"cdna_end": null,
"cdna_length": 1896,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 17,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1514_1562delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg505fs",
"transcript": "XM_017001333.2",
"protein_id": "XP_016856822.1",
"transcript_support_level": null,
"aa_start": 505,
"aa_end": null,
"aa_length": 535,
"cds_start": 1514,
"cds_end": null,
"cds_length": 1608,
"cdna_start": 1781,
"cdna_end": null,
"cdna_length": 1891,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 17,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1514_1562delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg505fs",
"transcript": "XM_047421194.1",
"protein_id": "XP_047277150.1",
"transcript_support_level": null,
"aa_start": 505,
"aa_end": null,
"aa_length": 535,
"cds_start": 1514,
"cds_end": null,
"cds_length": 1608,
"cdna_start": 1863,
"cdna_end": null,
"cdna_length": 1973,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1490_1538delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg497fs",
"transcript": "XM_047421197.1",
"protein_id": "XP_047277153.1",
"transcript_support_level": null,
"aa_start": 497,
"aa_end": null,
"aa_length": 527,
"cds_start": 1490,
"cds_end": null,
"cds_length": 1584,
"cdna_start": 3311,
"cdna_end": null,
"cdna_length": 3421,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 17,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1490_1538delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg497fs",
"transcript": "XM_047421198.1",
"protein_id": "XP_047277154.1",
"transcript_support_level": null,
"aa_start": 497,
"aa_end": null,
"aa_length": 527,
"cds_start": 1490,
"cds_end": null,
"cds_length": 1584,
"cdna_start": 2069,
"cdna_end": null,
"cdna_length": 2179,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1481_1529delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg494fs",
"transcript": "XM_047421199.1",
"protein_id": "XP_047277155.1",
"transcript_support_level": null,
"aa_start": 494,
"aa_end": null,
"aa_length": 524,
"cds_start": 1481,
"cds_end": null,
"cds_length": 1575,
"cdna_start": 2133,
"cdna_end": null,
"cdna_length": 2243,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 15,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1430_1478delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg477fs",
"transcript": "XM_047421201.1",
"protein_id": "XP_047277157.1",
"transcript_support_level": null,
"aa_start": 477,
"aa_end": null,
"aa_length": 507,
"cds_start": 1430,
"cds_end": null,
"cds_length": 1524,
"cdna_start": 1556,
"cdna_end": null,
"cdna_length": 1666,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1094_1142delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg365fs",
"transcript": "XM_047421203.1",
"protein_id": "XP_047277159.1",
"transcript_support_level": null,
"aa_start": 365,
"aa_end": null,
"aa_length": 395,
"cds_start": 1094,
"cds_end": null,
"cds_length": 1188,
"cdna_start": 1221,
"cdna_end": null,
"cdna_length": 1331,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RKKPRMGQQVLDNFFRS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 13,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.1085_1133delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg362fs",
"transcript": "XM_047421204.1",
"protein_id": "XP_047277160.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 392,
"cds_start": 1085,
"cds_end": null,
"cds_length": 1179,
"cdna_start": 1315,
"cdna_end": null,
"cdna_length": 1425,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SEKAPHGPASPG*",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"stop_lost"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.153_*12delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Ser51fs",
"transcript": "ENST00000531105.5",
"protein_id": "ENSP00000431292.1",
"transcript_support_level": 5,
"aa_start": 51,
"aa_end": null,
"aa_length": 62,
"cds_start": 153,
"cds_end": null,
"cds_length": 189,
"cdna_start": 395,
"cdna_end": null,
"cdna_length": 501,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.*334_*382delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "ENST00000467459.6",
"protein_id": "ENSP00000435889.2",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1731,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.793_841delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "ENST00000482094.5",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 920,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 17,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.*215_*263delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "ENST00000485271.6",
"protein_id": "ENSP00000431264.2",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1862,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.*801_*849delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "ENST00000533178.6",
"protein_id": "ENSP00000436430.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1225,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 15,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.*801_*849delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "ENST00000672011.1",
"protein_id": "ENSP00000500418.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2209,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 14,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.*1562_*1610delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "ENST00000713749.1",
"protein_id": "ENSP00000519050.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2049,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 17,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.1880_1928delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "NR_146882.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2038,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.1729_1777delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "NR_146883.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1887,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 17,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.1876_1924delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "NR_176269.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2034,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 17,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.1739_1787delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "NR_176271.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1897,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 17,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.1803_1851delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "NR_176272.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1961,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.1761_1809delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "NR_176273.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1919,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 17,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.1816_1864delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "NR_176274.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1974,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "c.153_*12delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "ENST00000531105.5",
"protein_id": "ENSP00000431292.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 62,
"cds_start": -4,
"cds_end": null,
"cds_length": 189,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 501,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.*334_*382delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "ENST00000467459.6",
"protein_id": "ENSP00000435889.2",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1731,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 17,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.*215_*263delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "ENST00000485271.6",
"protein_id": "ENSP00000431264.2",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1862,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.*801_*849delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "ENST00000533178.6",
"protein_id": "ENSP00000436430.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1225,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 15,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.*801_*849delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "ENST00000672011.1",
"protein_id": "ENSP00000500418.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2209,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 14,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"hgvs_c": "n.*1562_*1610delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null,
"transcript": "ENST00000713749.1",
"protein_id": "ENSP00000519050.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2049,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "MUTYH",
"gene_hgnc_id": 7527,
"dbsnp": "rs1064794411",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 3.586,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 4,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "PVS1_Strong",
"acmg_by_gene": [
{
"score": 4,
"benign_score": 0,
"pathogenic_score": 4,
"criteria": [
"PVS1_Strong"
],
"verdict": "Uncertain_significance",
"transcript": "ENST00000456914.7",
"gene_symbol": "MUTYH",
"hgnc_id": 7527,
"effects": [
"frameshift_variant"
],
"inheritance_mode": "AD,AR",
"hgvs_c": "c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": "p.Arg491fs"
},
{
"score": 0,
"benign_score": 0,
"pathogenic_score": 0,
"criteria": [],
"verdict": "Uncertain_significance",
"transcript": "ENST00000671898.1",
"gene_symbol": "ENSG00000288208",
"hgnc_id": null,
"effects": [
"non_coding_transcript_exon_variant"
],
"inheritance_mode": "",
"hgvs_c": "n.*215_*263delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC",
"hgvs_p": null
}
],
"clinvar_disease": "Familial adenomatous polyposis 2,Hereditary cancer-predisposing syndrome,not provided",
"clinvar_classification": "Uncertain significance",
"clinvar_review_status": "criteria provided, multiple submitters, no conflicts",
"clinvar_submissions_summary": "US:3",
"phenotype_combined": "not provided|Familial adenomatous polyposis 2|Hereditary cancer-predisposing syndrome",
"pathogenicity_classification_combined": "Uncertain significance",
"custom_annotations": null
}
],
"message": null
}