← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 1-930081-AGCCCCACCTTCCTCTCCTCCTGCCCCACCTTCCTCTCCTCCT-A (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=1&pos=930081&ref=AGCCCCACCTTCCTCTCCTCCTGCCCCACCTTCCTCTCCTCCT&alt=A&genome=hg38&allGenes=true"

API Response

json
{
  "message": null,
  "variants": [
    {
      "acmg_by_gene": [
        {
          "benign_score": 0,
          "criteria": [],
          "effects": [
            "splice_region_variant",
            "intron_variant"
          ],
          "gene_symbol": "SAMD11",
          "hgnc_id": 28706,
          "hgvs_c": "c.610-44_610-3delTTCCTCTCCTCCTGCCCCACCTTCCTCTCCTCCTGCCCCACC",
          "hgvs_p": null,
          "inheritance_mode": "AR",
          "pathogenic_score": 0,
          "score": 0,
          "transcript": "NM_001385640.1",
          "verdict": "Uncertain_significance"
        }
      ],
      "acmg_classification": "Uncertain_significance",
      "acmg_criteria": "",
      "acmg_score": 0,
      "allele_count_reference_population": 10,
      "alphamissense_prediction": null,
      "alphamissense_score": null,
      "alt": "A",
      "apogee2_prediction": null,
      "apogee2_score": null,
      "bayesdelnoaf_prediction": null,
      "bayesdelnoaf_score": null,
      "chr": "1",
      "clinvar_classification": "",
      "clinvar_disease": "",
      "clinvar_review_status": "",
      "clinvar_submissions_summary": "",
      "computational_prediction_selected": null,
      "computational_score_selected": null,
      "computational_source_selected": null,
      "consequences": [
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 844,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 3465,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2535,
          "cds_start": null,
          "consequences": [
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_count": 14,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "NM_001385641.1",
          "gene_hgnc_id": 28706,
          "gene_symbol": "SAMD11",
          "hgvs_c": "c.610-44_610-3delTTCCTCTCCTCCTGCCCCACCTTCCTCTCCTCCTGCCCCACC",
          "hgvs_p": null,
          "intron_rank": 2,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": "ENST00000616016.5",
          "protein_coding": true,
          "protein_id": "NP_001372570.1",
          "strand": true,
          "transcript": "NM_001385641.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 844,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": true,
          "cdna_end": null,
          "cdna_length": 3465,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2535,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 14,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000616016.5",
          "gene_hgnc_id": 28706,
          "gene_symbol": "SAMD11",
          "hgvs_c": "c.610-73_610-32delGCCCCACCTTCCTCTCCTCCTGCCCCACCTTCCTCTCCTCCT",
          "hgvs_p": null,
          "intron_rank": 2,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": "NM_001385641.1",
          "protein_coding": true,
          "protein_id": "ENSP00000478421.2",
          "strand": true,
          "transcript": "ENST00000616016.5",
          "transcript_support_level": 5
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 850,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 3482,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2553,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 14,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000968543.1",
          "gene_hgnc_id": 28706,
          "gene_symbol": "SAMD11",
          "hgvs_c": "c.610-73_610-32delGCCCCACCTTCCTCTCCTCCTGCCCCACCTTCCTCTCCTCCT",
          "hgvs_p": null,
          "intron_rank": 2,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000638602.1",
          "strand": true,
          "transcript": "ENST00000968543.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 845,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 3468,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2538,
          "cds_start": null,
          "consequences": [
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_count": 14,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "NM_001385640.1",
          "gene_hgnc_id": 28706,
          "gene_symbol": "SAMD11",
          "hgvs_c": "c.610-44_610-3delTTCCTCTCCTCCTGCCCCACCTTCCTCTCCTCCTGCCCCACC",
          "hgvs_p": null,
          "intron_rank": 2,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "NP_001372569.1",
          "strand": true,
          "transcript": "NM_001385640.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 845,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 3468,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2538,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 14,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000618323.5",
          "gene_hgnc_id": 28706,
          "gene_symbol": "SAMD11",
          "hgvs_c": "c.610-73_610-32delGCCCCACCTTCCTCTCCTCCTGCCCCACCTTCCTCTCCTCCT",
          "hgvs_p": null,
          "intron_rank": 2,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000480678.2",
          "strand": true,
          "transcript": "ENST00000618323.5",
          "transcript_support_level": 5
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 815,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 3376,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2448,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 14,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000968544.1",
          "gene_hgnc_id": 28706,
          "gene_symbol": "SAMD11",
          "hgvs_c": "c.610-73_610-32delGCCCCACCTTCCTCTCCTCCTGCCCCACCTTCCTCTCCTCCT",
          "hgvs_p": null,
          "intron_rank": 2,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000638603.1",
          "strand": true,
          "transcript": "ENST00000968544.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 751,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 3185,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2256,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 12,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000968542.1",
          "gene_hgnc_id": 28706,
          "gene_symbol": "SAMD11",
          "hgvs_c": "c.610-73_610-32delGCCCCACCTTCCTCTCCTCCTGCCCCACCTTCCTCTCCTCCT",
          "hgvs_p": null,
          "intron_rank": 2,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000638601.1",
          "strand": true,
          "transcript": "ENST00000968542.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 682,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 2049,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2049,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 13,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000622503.5",
          "gene_hgnc_id": 28706,
          "gene_symbol": "SAMD11",
          "hgvs_c": "c.73-73_73-32delGCCCCACCTTCCTCTCCTCCTGCCCCACCTTCCTCTCCTCCT",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000482138.1",
          "strand": true,
          "transcript": "ENST00000622503.5",
          "transcript_support_level": 5
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 681,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 2557,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2046,
          "cds_start": null,
          "consequences": [
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_count": 14,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "NM_152486.4",
          "gene_hgnc_id": 28706,
          "gene_symbol": "SAMD11",
          "hgvs_c": "c.73-44_73-3delTTCCTCTCCTCCTGCCCCACCTTCCTCTCCTCCTGCCCCACC",
          "hgvs_p": null,
          "intron_rank": 2,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "NP_689699.3",
          "strand": true,
          "transcript": "NM_152486.4",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 681,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 2557,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2046,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 14,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000342066.8",
          "gene_hgnc_id": 28706,
          "gene_symbol": "SAMD11",
          "hgvs_c": "c.73-73_73-32delGCCCCACCTTCCTCTCCTCCTGCCCCACCTTCCTCTCCTCCT",
          "hgvs_p": null,
          "intron_rank": 2,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000342313.3",
          "strand": true,
          "transcript": "ENST00000342066.8",
          "transcript_support_level": 5
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 661,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 1986,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1986,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 13,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000617307.5",
          "gene_hgnc_id": 28706,
          "gene_symbol": "SAMD11",
          "hgvs_c": "c.73-73_73-32delGCCCCACCTTCCTCTCCTCCTGCCCCACCTTCCTCTCCTCCT",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000482090.2",
          "strand": true,
          "transcript": "ENST00000617307.5",
          "transcript_support_level": 5
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 619,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 1860,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1860,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 12,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000618779.5",
          "gene_hgnc_id": 28706,
          "gene_symbol": "SAMD11",
          "hgvs_c": "c.73-73_73-32delGCCCCACCTTCCTCTCCTCCTGCCCCACCTTCCTCTCCTCCT",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000484256.1",
          "strand": true,
          "transcript": "ENST00000618779.5",
          "transcript_support_level": 5
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 573,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 1722,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1722,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 11,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000616125.5",
          "gene_hgnc_id": 28706,
          "gene_symbol": "SAMD11",
          "hgvs_c": "c.73-73_73-32delGCCCCACCTTCCTCTCCTCCTGCCCCACCTTCCTCTCCTCCT",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000484643.1",
          "strand": true,
          "transcript": "ENST00000616125.5",
          "transcript_support_level": 5
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 556,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 1671,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1671,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 10,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000618181.5",
          "gene_hgnc_id": 28706,
          "gene_symbol": "SAMD11",
          "hgvs_c": "c.73-73_73-32delGCCCCACCTTCCTCTCCTCCTGCCCCACCTTCCTCTCCTCCT",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000480870.1",
          "strand": true,
          "transcript": "ENST00000618181.5",
          "transcript_support_level": 5
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 108,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 387,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 327,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 5,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000437963.5",
          "gene_hgnc_id": 28706,
          "gene_symbol": "SAMD11",
          "hgvs_c": "c.73-73_73-32delGCCCCACCTTCCTCTCCTCCTGCCCCACCTTCCTCTCCTCCT",
          "hgvs_p": null,
          "intron_rank": 2,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000393181.1",
          "strand": true,
          "transcript": "ENST00000437963.5",
          "transcript_support_level": 5
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 588,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 2191,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1767,
          "cds_start": null,
          "consequences": [
            "upstream_gene_variant"
          ],
          "exon_count": 12,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000341065.8",
          "gene_hgnc_id": 28706,
          "gene_symbol": "SAMD11",
          "hgvs_c": "c.-232_-191delGCCCCACCTTCCTCTCCTCCTGCCCCACCTTCCTCTCCTCCT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000349216.4",
          "strand": true,
          "transcript": "ENST00000341065.8",
          "transcript_support_level": 5
        }
      ],
      "custom_annotations": null,
      "dbscsnv_ada_prediction": null,
      "dbscsnv_ada_score": null,
      "dbsnp": "rs879326979",
      "effect": "splice_region_variant,intron_variant",
      "frequency_reference_population": 0.0000075557805,
      "gene_hgnc_id": 28706,
      "gene_symbol": "SAMD11",
      "gnomad_exomes_ac": 10,
      "gnomad_exomes_af": 0.00000755578,
      "gnomad_exomes_homalt": 0,
      "gnomad_genomes_ac": null,
      "gnomad_genomes_af": null,
      "gnomad_genomes_homalt": null,
      "gnomad_mito_heteroplasmic": null,
      "gnomad_mito_homoplasmic": null,
      "hom_count_reference_population": 0,
      "mitotip_prediction": null,
      "mitotip_score": null,
      "pathogenicity_classification_combined": null,
      "phenotype_combined": null,
      "phylop100way_prediction": "Benign",
      "phylop100way_score": 1.347,
      "pos": 930081,
      "ref": "AGCCCCACCTTCCTCTCCTCCTGCCCCACCTTCCTCTCCTCCT",
      "revel_prediction": null,
      "revel_score": null,
      "splice_prediction_selected": null,
      "splice_score_selected": null,
      "splice_source_selected": null,
      "spliceai_max_prediction": null,
      "spliceai_max_score": null,
      "transcript": "NM_001385640.1"
    }
  ]
}
For research and educational, non-commercial use only. Not for clinical or diagnostic use. GeneBe does not provide medical advice. Data use for AI modeling is prohibited: if used, the cost is $0.001 per byte of downloaded uncompressed data.