← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 10-43113625-ACTGCTTCCCTGAGGAGGAGAAGTGCTT-A (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=10&pos=43113625&ref=ACTGCTTCCCTGAGGAGGAGAAGTGCTT&alt=A&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "10",
"pos": 43113625,
"ref": "ACTGCTTCCCTGAGGAGGAGAAGTGCTT",
"alt": "A",
"effect": "conservative_inframe_deletion",
"transcript": "ENST00000355710.8",
"consequences": [
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1834_1860delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe612_Cys620del",
"transcript": "NM_020975.6",
"protein_id": "NP_066124.1",
"transcript_support_level": null,
"aa_start": 612,
"aa_end": null,
"aa_length": 1114,
"cds_start": 1834,
"cds_end": null,
"cds_length": 3345,
"cdna_start": 2024,
"cdna_end": null,
"cdna_length": 5617,
"mane_select": "ENST00000355710.8",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1834_1860delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe612_Cys620del",
"transcript": "ENST00000355710.8",
"protein_id": "ENSP00000347942.3",
"transcript_support_level": 5,
"aa_start": 612,
"aa_end": null,
"aa_length": 1114,
"cds_start": 1834,
"cds_end": null,
"cds_length": 3345,
"cdna_start": 2024,
"cdna_end": null,
"cdna_length": 5617,
"mane_select": "NM_020975.6",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1834_1860delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe612_Cys620del",
"transcript": "ENST00000340058.6",
"protein_id": "ENSP00000344798.4",
"transcript_support_level": 1,
"aa_start": 612,
"aa_end": null,
"aa_length": 1072,
"cds_start": 1834,
"cds_end": null,
"cds_length": 3219,
"cdna_start": 2024,
"cdna_end": null,
"cdna_length": 4159,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1834_1860delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe612_Cys620del",
"transcript": "NM_001406743.1",
"protein_id": "NP_001393672.1",
"transcript_support_level": null,
"aa_start": 612,
"aa_end": null,
"aa_length": 1114,
"cds_start": 1834,
"cds_end": null,
"cds_length": 3345,
"cdna_start": 2024,
"cdna_end": null,
"cdna_length": 4385,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1834_1860delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe612_Cys620del",
"transcript": "NM_001406744.1",
"protein_id": "NP_001393673.1",
"transcript_support_level": null,
"aa_start": 612,
"aa_end": null,
"aa_length": 1106,
"cds_start": 1834,
"cds_end": null,
"cds_length": 3321,
"cdna_start": 2024,
"cdna_end": null,
"cdna_length": 4211,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1834_1860delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe612_Cys620del",
"transcript": "NM_001406759.1",
"protein_id": "NP_001393688.1",
"transcript_support_level": null,
"aa_start": 612,
"aa_end": null,
"aa_length": 1094,
"cds_start": 1834,
"cds_end": null,
"cds_length": 3285,
"cdna_start": 2024,
"cdna_end": null,
"cdna_length": 5557,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1834_1860delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe612_Cys620del",
"transcript": "NM_001406760.1",
"protein_id": "NP_001393689.1",
"transcript_support_level": null,
"aa_start": 612,
"aa_end": null,
"aa_length": 1094,
"cds_start": 1834,
"cds_end": null,
"cds_length": 3285,
"cdna_start": 2024,
"cdna_end": null,
"cdna_length": 4325,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1834_1860delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe612_Cys620del",
"transcript": "NM_020630.7",
"protein_id": "NP_065681.1",
"transcript_support_level": null,
"aa_start": 612,
"aa_end": null,
"aa_length": 1072,
"cds_start": 1834,
"cds_end": null,
"cds_length": 3219,
"cdna_start": 2024,
"cdna_end": null,
"cdna_length": 7006,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1705_1731delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe569_Cys577del",
"transcript": "NM_001406761.1",
"protein_id": "NP_001393690.1",
"transcript_support_level": null,
"aa_start": 569,
"aa_end": null,
"aa_length": 1071,
"cds_start": 1705,
"cds_end": null,
"cds_length": 3216,
"cdna_start": 1895,
"cdna_end": null,
"cdna_length": 4256,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1705_1731delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe569_Cys577del",
"transcript": "NM_001406762.1",
"protein_id": "NP_001393691.1",
"transcript_support_level": null,
"aa_start": 569,
"aa_end": null,
"aa_length": 1071,
"cds_start": 1705,
"cds_end": null,
"cds_length": 3216,
"cdna_start": 1895,
"cdna_end": null,
"cdna_length": 5488,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1834_1860delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe612_Cys620del",
"transcript": "NM_001406763.1",
"protein_id": "NP_001393692.1",
"transcript_support_level": null,
"aa_start": 612,
"aa_end": null,
"aa_length": 1069,
"cds_start": 1834,
"cds_end": null,
"cds_length": 3210,
"cdna_start": 2024,
"cdna_end": null,
"cdna_length": 5482,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1705_1731delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe569_Cys577del",
"transcript": "NM_001406764.1",
"protein_id": "NP_001393693.1",
"transcript_support_level": null,
"aa_start": 569,
"aa_end": null,
"aa_length": 1029,
"cds_start": 1705,
"cds_end": null,
"cds_length": 3090,
"cdna_start": 1895,
"cdna_end": null,
"cdna_length": 6877,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1834_1860delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe612_Cys620del",
"transcript": "NM_001406765.1",
"protein_id": "NP_001393694.1",
"transcript_support_level": null,
"aa_start": 612,
"aa_end": null,
"aa_length": 1027,
"cds_start": 1834,
"cds_end": null,
"cds_length": 3084,
"cdna_start": 2024,
"cdna_end": null,
"cdna_length": 6871,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1546_1572delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe516_Cys524del",
"transcript": "NM_001406766.1",
"protein_id": "NP_001393695.1",
"transcript_support_level": null,
"aa_start": 516,
"aa_end": null,
"aa_length": 1018,
"cds_start": 1546,
"cds_end": null,
"cds_length": 3057,
"cdna_start": 1736,
"cdna_end": null,
"cdna_length": 5329,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1546_1572delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe516_Cys524del",
"transcript": "NM_001406767.1",
"protein_id": "NP_001393696.1",
"transcript_support_level": null,
"aa_start": 516,
"aa_end": null,
"aa_length": 1018,
"cds_start": 1546,
"cds_end": null,
"cds_length": 3057,
"cdna_start": 1736,
"cdna_end": null,
"cdna_length": 4097,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1705_1731delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe569_Cys577del",
"transcript": "NM_001406768.1",
"protein_id": "NP_001393697.1",
"transcript_support_level": null,
"aa_start": 569,
"aa_end": null,
"aa_length": 984,
"cds_start": 1705,
"cds_end": null,
"cds_length": 2955,
"cdna_start": 1895,
"cdna_end": null,
"cdna_length": 6742,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1705_1731delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe569_Cys577del",
"transcript": "ENST00000713926.1",
"protein_id": "ENSP00000519223.1",
"transcript_support_level": null,
"aa_start": 569,
"aa_end": null,
"aa_length": 984,
"cds_start": 1705,
"cds_end": null,
"cds_length": 2955,
"cdna_start": 1896,
"cdna_end": null,
"cdna_length": 3896,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1438_1464delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe480_Cys488del",
"transcript": "NM_001406769.1",
"protein_id": "NP_001393698.1",
"transcript_support_level": null,
"aa_start": 480,
"aa_end": null,
"aa_length": 982,
"cds_start": 1438,
"cds_end": null,
"cds_length": 2949,
"cdna_start": 1628,
"cdna_end": null,
"cdna_length": 3989,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1546_1572delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe516_Cys524del",
"transcript": "NM_001406770.1",
"protein_id": "NP_001393699.1",
"transcript_support_level": null,
"aa_start": 516,
"aa_end": null,
"aa_length": 976,
"cds_start": 1546,
"cds_end": null,
"cds_length": 2931,
"cdna_start": 1736,
"cdna_end": null,
"cdna_length": 6718,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1396_1422delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe466_Cys474del",
"transcript": "NM_001406771.1",
"protein_id": "NP_001393700.1",
"transcript_support_level": null,
"aa_start": 466,
"aa_end": null,
"aa_length": 968,
"cds_start": 1396,
"cds_end": null,
"cds_length": 2907,
"cdna_start": 1586,
"cdna_end": null,
"cdna_length": 5179,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1438_1464delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe480_Cys488del",
"transcript": "NM_001406772.1",
"protein_id": "NP_001393701.1",
"transcript_support_level": null,
"aa_start": 480,
"aa_end": null,
"aa_length": 940,
"cds_start": 1438,
"cds_end": null,
"cds_length": 2823,
"cdna_start": 1628,
"cdna_end": null,
"cdna_length": 6610,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1438_1464delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe480_Cys488del",
"transcript": "ENST00000615310.5",
"protein_id": "ENSP00000480088.2",
"transcript_support_level": 5,
"aa_start": 480,
"aa_end": null,
"aa_length": 940,
"cds_start": 1438,
"cds_end": null,
"cds_length": 2823,
"cdna_start": 1611,
"cdna_end": null,
"cdna_length": 6513,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1396_1422delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe466_Cys474del",
"transcript": "NM_001406773.1",
"protein_id": "NP_001393702.1",
"transcript_support_level": null,
"aa_start": 466,
"aa_end": null,
"aa_length": 926,
"cds_start": 1396,
"cds_end": null,
"cds_length": 2781,
"cdna_start": 1586,
"cdna_end": null,
"cdna_length": 6568,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1309_1335delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe437_Cys445del",
"transcript": "NM_001406774.1",
"protein_id": "NP_001393703.1",
"transcript_support_level": null,
"aa_start": 437,
"aa_end": null,
"aa_length": 897,
"cds_start": 1309,
"cds_end": null,
"cds_length": 2694,
"cdna_start": 1499,
"cdna_end": null,
"cdna_length": 6481,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1108_1134delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe370_Cys378del",
"transcript": "NM_001406775.1",
"protein_id": "NP_001393704.1",
"transcript_support_level": null,
"aa_start": 370,
"aa_end": null,
"aa_length": 872,
"cds_start": 1108,
"cds_end": null,
"cds_length": 2619,
"cdna_start": 1298,
"cdna_end": null,
"cdna_length": 4891,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1108_1134delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe370_Cys378del",
"transcript": "NM_001406776.1",
"protein_id": "NP_001393705.1",
"transcript_support_level": null,
"aa_start": 370,
"aa_end": null,
"aa_length": 864,
"cds_start": 1108,
"cds_end": null,
"cds_length": 2595,
"cdna_start": 1298,
"cdna_end": null,
"cdna_length": 3485,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1108_1134delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe370_Cys378del",
"transcript": "NM_001406777.1",
"protein_id": "NP_001393706.1",
"transcript_support_level": null,
"aa_start": 370,
"aa_end": null,
"aa_length": 852,
"cds_start": 1108,
"cds_end": null,
"cds_length": 2559,
"cdna_start": 1298,
"cdna_end": null,
"cdna_length": 4831,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1108_1134delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe370_Cys378del",
"transcript": "NM_001406778.1",
"protein_id": "NP_001393707.1",
"transcript_support_level": null,
"aa_start": 370,
"aa_end": null,
"aa_length": 830,
"cds_start": 1108,
"cds_end": null,
"cds_length": 2493,
"cdna_start": 1298,
"cdna_end": null,
"cdna_length": 6280,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.1072_1098delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe358_Cys366del",
"transcript": "NM_001355216.2",
"protein_id": "NP_001342145.1",
"transcript_support_level": null,
"aa_start": 358,
"aa_end": null,
"aa_length": 818,
"cds_start": 1072,
"cds_end": null,
"cds_length": 2457,
"cdna_start": 1396,
"cdna_end": null,
"cdna_length": 6378,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.937_963delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe313_Cys321del",
"transcript": "NM_001406779.1",
"protein_id": "NP_001393708.1",
"transcript_support_level": null,
"aa_start": 313,
"aa_end": null,
"aa_length": 815,
"cds_start": 937,
"cds_end": null,
"cds_length": 2448,
"cdna_start": 1127,
"cdna_end": null,
"cdna_length": 3488,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.937_963delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe313_Cys321del",
"transcript": "NM_001406780.1",
"protein_id": "NP_001393709.1",
"transcript_support_level": null,
"aa_start": 313,
"aa_end": null,
"aa_length": 815,
"cds_start": 937,
"cds_end": null,
"cds_length": 2448,
"cdna_start": 1127,
"cdna_end": null,
"cdna_length": 4720,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.937_963delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe313_Cys321del",
"transcript": "NM_001406781.1",
"protein_id": "NP_001393710.1",
"transcript_support_level": null,
"aa_start": 313,
"aa_end": null,
"aa_length": 807,
"cds_start": 937,
"cds_end": null,
"cds_length": 2424,
"cdna_start": 1127,
"cdna_end": null,
"cdna_length": 3314,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.937_963delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe313_Cys321del",
"transcript": "NM_001406782.1",
"protein_id": "NP_001393711.1",
"transcript_support_level": null,
"aa_start": 313,
"aa_end": null,
"aa_length": 773,
"cds_start": 937,
"cds_end": null,
"cds_length": 2322,
"cdna_start": 1127,
"cdna_end": null,
"cdna_length": 6109,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.808_834delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe270_Cys278del",
"transcript": "NM_001406783.1",
"protein_id": "NP_001393712.1",
"transcript_support_level": null,
"aa_start": 270,
"aa_end": null,
"aa_length": 772,
"cds_start": 808,
"cds_end": null,
"cds_length": 2319,
"cdna_start": 998,
"cdna_end": null,
"cdna_length": 4591,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.844_870delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe282_Cys290del",
"transcript": "NM_001406784.1",
"protein_id": "NP_001393713.1",
"transcript_support_level": null,
"aa_start": 282,
"aa_end": null,
"aa_length": 742,
"cds_start": 844,
"cds_end": null,
"cds_length": 2229,
"cdna_start": 1034,
"cdna_end": null,
"cdna_length": 6016,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.808_834delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe270_Cys278del",
"transcript": "NM_001406786.1",
"protein_id": "NP_001393715.1",
"transcript_support_level": null,
"aa_start": 270,
"aa_end": null,
"aa_length": 730,
"cds_start": 808,
"cds_end": null,
"cds_length": 2193,
"cdna_start": 998,
"cdna_end": null,
"cdna_length": 5980,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.937_963delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe313_Cys321del",
"transcript": "NM_001406787.1",
"protein_id": "NP_001393716.1",
"transcript_support_level": null,
"aa_start": 313,
"aa_end": null,
"aa_length": 728,
"cds_start": 937,
"cds_end": null,
"cds_length": 2187,
"cdna_start": 1127,
"cdna_end": null,
"cdna_length": 5974,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.649_675delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe217_Cys225del",
"transcript": "NM_001406788.1",
"protein_id": "NP_001393717.1",
"transcript_support_level": null,
"aa_start": 217,
"aa_end": null,
"aa_length": 719,
"cds_start": 649,
"cds_end": null,
"cds_length": 2160,
"cdna_start": 839,
"cdna_end": null,
"cdna_length": 4432,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.649_675delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe217_Cys225del",
"transcript": "NM_001406789.1",
"protein_id": "NP_001393718.1",
"transcript_support_level": null,
"aa_start": 217,
"aa_end": null,
"aa_length": 719,
"cds_start": 649,
"cds_end": null,
"cds_length": 2160,
"cdna_start": 839,
"cdna_end": null,
"cdna_length": 3200,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.649_675delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe217_Cys225del",
"transcript": "NM_001406790.1",
"protein_id": "NP_001393719.1",
"transcript_support_level": null,
"aa_start": 217,
"aa_end": null,
"aa_length": 677,
"cds_start": 649,
"cds_end": null,
"cds_length": 2034,
"cdna_start": 839,
"cdna_end": null,
"cdna_length": 5821,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.385_411delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe129_Cys137del",
"transcript": "NM_001406792.1",
"protein_id": "NP_001393721.1",
"transcript_support_level": null,
"aa_start": 129,
"aa_end": null,
"aa_length": 631,
"cds_start": 385,
"cds_end": null,
"cds_length": 1896,
"cdna_start": 575,
"cdna_end": null,
"cdna_length": 4168,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.385_411delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe129_Cys137del",
"transcript": "NM_001406793.1",
"protein_id": "NP_001393722.1",
"transcript_support_level": null,
"aa_start": 129,
"aa_end": null,
"aa_length": 611,
"cds_start": 385,
"cds_end": null,
"cds_length": 1836,
"cdna_start": 575,
"cdna_end": null,
"cdna_length": 2876,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.385_411delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe129_Cys137del",
"transcript": "NM_001406794.1",
"protein_id": "NP_001393723.1",
"transcript_support_level": null,
"aa_start": 129,
"aa_end": null,
"aa_length": 589,
"cds_start": 385,
"cds_end": null,
"cds_length": 1770,
"cdna_start": 575,
"cdna_end": null,
"cdna_length": 5557,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "FPEEEKCFC",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.385_411delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe129_Cys137del",
"transcript": "ENST00000498820.5",
"protein_id": "ENSP00000419080.1",
"transcript_support_level": 3,
"aa_start": 129,
"aa_end": null,
"aa_length": 180,
"cds_start": 385,
"cds_end": null,
"cds_length": 544,
"cdna_start": 570,
"cdna_end": null,
"cdna_length": 729,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "n.*428_*454delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": null,
"transcript": "ENST00000671844.1",
"protein_id": "ENSP00000500541.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3457,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "n.*428_*454delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": null,
"transcript": "ENST00000672389.1",
"protein_id": "ENSP00000500252.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2240,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "n.1408_1434delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": null,
"transcript": "ENST00000683007.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6310,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "n.595_621delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": null,
"transcript": "ENST00000683872.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3004,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "n.*428_*454delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": null,
"transcript": "ENST00000671844.1",
"protein_id": "ENSP00000500541.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3457,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "n.*428_*454delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": null,
"transcript": "ENST00000672389.1",
"protein_id": "ENSP00000500252.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2240,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.862+667_862+693delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": null,
"transcript": "NM_001406785.1",
"protein_id": "NP_001393714.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 733,
"cds_start": -4,
"cds_end": null,
"cds_length": 2202,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5989,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"hgvs_c": "c.574+667_574+693delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": null,
"transcript": "NM_001406791.1",
"protein_id": "NP_001393720.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 637,
"cds_start": -4,
"cds_end": null,
"cds_length": 1914,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5701,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "RET",
"gene_hgnc_id": 9967,
"dbsnp": "rs121913313",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 8.14,
"phylop100way_prediction": "Pathogenic",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 5,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "PM1,PM4,PP3",
"acmg_by_gene": [
{
"score": 5,
"benign_score": 0,
"pathogenic_score": 5,
"criteria": [
"PM1",
"PM4",
"PP3"
],
"verdict": "Uncertain_significance",
"transcript": "ENST00000355710.8",
"gene_symbol": "RET",
"hgnc_id": 9967,
"effects": [
"conservative_inframe_deletion"
],
"inheritance_mode": "AD,AR",
"hgvs_c": "c.1834_1860delTTCCCTGAGGAGGAGAAGTGCTTCTGC",
"hgvs_p": "p.Phe612_Cys620del"
}
],
"clinvar_disease": "",
"clinvar_classification": "",
"clinvar_review_status": "",
"clinvar_submissions_summary": "",
"phenotype_combined": null,
"pathogenicity_classification_combined": null,
"custom_annotations": null
}
],
"message": null
}