← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 10-77637591-CGCCGCCGCCGCCGCCGCTGCT-C (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=10&pos=77637591&ref=CGCCGCCGCCGCCGCCGCTGCT&alt=C&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "10",
"pos": 77637591,
"ref": "CGCCGCCGCCGCCGCCGCTGCT",
"alt": "C",
"effect": "conservative_inframe_deletion",
"transcript": "ENST00000286628.14",
"consequences": [
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "NM_001161352.2",
"protein_id": "NP_001154824.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1236,
"cds_start": 31,
"cds_end": null,
"cds_length": 3711,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 6261,
"mane_select": "ENST00000286628.14",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000286628.14",
"protein_id": "ENSP00000286628.8",
"transcript_support_level": 1,
"aa_start": 11,
"aa_end": null,
"aa_length": 1236,
"cds_start": 31,
"cds_end": null,
"cds_length": 3711,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 6261,
"mane_select": "NM_001161352.2",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000626620.3",
"protein_id": "ENSP00000485867.1",
"transcript_support_level": 1,
"aa_start": 11,
"aa_end": null,
"aa_length": 1219,
"cds_start": 31,
"cds_end": null,
"cds_length": 3660,
"cdna_start": 51,
"cdna_end": null,
"cdna_length": 3660,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000639406.1",
"protein_id": "ENSP00000491732.1",
"transcript_support_level": 1,
"aa_start": 11,
"aa_end": null,
"aa_length": 1208,
"cds_start": 31,
"cds_end": null,
"cds_length": 3627,
"cdna_start": 131,
"cdna_end": null,
"cdna_length": 5567,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000286627.10",
"protein_id": "ENSP00000286627.5",
"transcript_support_level": 1,
"aa_start": 11,
"aa_end": null,
"aa_length": 1178,
"cds_start": 31,
"cds_end": null,
"cds_length": 3537,
"cdna_start": 311,
"cdna_end": null,
"cdna_length": 6194,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000640807.1",
"protein_id": "ENSP00000491555.1",
"transcript_support_level": 1,
"aa_start": 11,
"aa_end": null,
"aa_length": 1128,
"cds_start": 31,
"cds_end": null,
"cds_length": 3387,
"cdna_start": 51,
"cdna_end": null,
"cdna_length": 3387,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000618048.2",
"protein_id": "ENSP00000482747.1",
"transcript_support_level": 1,
"aa_start": 11,
"aa_end": null,
"aa_length": 213,
"cds_start": 31,
"cds_end": null,
"cds_length": 642,
"cdna_start": 134,
"cdna_end": null,
"cdna_length": 1269,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000480683.2",
"protein_id": "ENSP00000474686.1",
"transcript_support_level": 1,
"aa_start": 11,
"aa_end": null,
"aa_length": 168,
"cds_start": 31,
"cds_end": null,
"cds_length": 507,
"cdna_start": 230,
"cdna_end": null,
"cdna_length": 2963,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000404771.8",
"protein_id": "ENSP00000385717.3",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1288,
"cds_start": 31,
"cds_end": null,
"cds_length": 3867,
"cdna_start": 184,
"cdna_end": null,
"cdna_length": 4014,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 31,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000639591.1",
"protein_id": "ENSP00000492793.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1246,
"cds_start": 31,
"cds_end": null,
"cds_length": 3741,
"cdna_start": 184,
"cdna_end": null,
"cdna_length": 3888,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 31,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000640523.1",
"protein_id": "ENSP00000491795.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1242,
"cds_start": 31,
"cds_end": null,
"cds_length": 3729,
"cdna_start": 524,
"cdna_end": null,
"cdna_length": 5425,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000638759.1",
"protein_id": "ENSP00000492632.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1240,
"cds_start": 31,
"cds_end": null,
"cds_length": 3723,
"cdna_start": 51,
"cdna_end": null,
"cdna_length": 3723,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000638575.1",
"protein_id": "ENSP00000492049.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1239,
"cds_start": 31,
"cds_end": null,
"cds_length": 3720,
"cdna_start": 51,
"cdna_end": null,
"cdna_length": 3720,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000638848.1",
"protein_id": "ENSP00000492414.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1239,
"cds_start": 31,
"cds_end": null,
"cds_length": 3720,
"cdna_start": 131,
"cdna_end": null,
"cdna_length": 4423,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 31,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000640605.1",
"protein_id": "ENSP00000491435.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1238,
"cds_start": 31,
"cds_end": null,
"cds_length": 3717,
"cdna_start": 184,
"cdna_end": null,
"cdna_length": 3864,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000639544.1",
"protein_id": "ENSP00000492075.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1236,
"cds_start": 31,
"cds_end": null,
"cds_length": 3711,
"cdna_start": 51,
"cdna_end": null,
"cdna_length": 3711,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000457953.6",
"protein_id": "ENSP00000396608.2",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1235,
"cds_start": 31,
"cds_end": null,
"cds_length": 3708,
"cdna_start": 175,
"cdna_end": null,
"cdna_length": 3976,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000638606.1",
"protein_id": "ENSP00000491981.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1234,
"cds_start": 31,
"cds_end": null,
"cds_length": 3705,
"cdna_start": 184,
"cdna_end": null,
"cdna_length": 3852,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000640182.1",
"protein_id": "ENSP00000492510.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1234,
"cds_start": 31,
"cds_end": null,
"cds_length": 3705,
"cdna_start": 184,
"cdna_end": null,
"cdna_length": 3852,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000372440.6",
"protein_id": "ENSP00000361517.2",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1233,
"cds_start": 31,
"cds_end": null,
"cds_length": 3702,
"cdna_start": 184,
"cdna_end": null,
"cdna_length": 3849,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000638351.1",
"protein_id": "ENSP00000491156.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1233,
"cds_start": 31,
"cds_end": null,
"cds_length": 3702,
"cdna_start": 184,
"cdna_end": null,
"cdna_length": 3849,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000638203.1",
"protein_id": "ENSP00000491123.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1230,
"cds_start": 31,
"cds_end": null,
"cds_length": 3693,
"cdna_start": 184,
"cdna_end": null,
"cdna_length": 3840,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000639090.1",
"protein_id": "ENSP00000491673.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1230,
"cds_start": 31,
"cds_end": null,
"cds_length": 3693,
"cdna_start": 184,
"cdna_end": null,
"cdna_length": 4319,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "NM_001437422.1",
"protein_id": "NP_001424351.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1222,
"cds_start": 31,
"cds_end": null,
"cds_length": 3669,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 6219,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "NM_001161353.2",
"protein_id": "NP_001154825.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1219,
"cds_start": 31,
"cds_end": null,
"cds_length": 3660,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 6210,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 31,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "NM_001322830.2",
"protein_id": "NP_001309759.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1212,
"cds_start": 31,
"cds_end": null,
"cds_length": 3639,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12072,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 31,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000638223.1",
"protein_id": "ENSP00000492492.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1212,
"cds_start": 31,
"cds_end": null,
"cds_length": 3639,
"cdna_start": 51,
"cdna_end": null,
"cdna_length": 4340,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "NM_001322837.2",
"protein_id": "NP_001309766.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1209,
"cds_start": 31,
"cds_end": null,
"cds_length": 3630,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 6180,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000372443.6",
"protein_id": "ENSP00000361520.2",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1209,
"cds_start": 31,
"cds_end": null,
"cds_length": 3630,
"cdna_start": 778,
"cdna_end": null,
"cdna_length": 5059,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "NM_001271519.2",
"protein_id": "NP_001258448.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1208,
"cds_start": 31,
"cds_end": null,
"cds_length": 3627,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 6177,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "NM_001322835.2",
"protein_id": "NP_001309764.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1208,
"cds_start": 31,
"cds_end": null,
"cds_length": 3627,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12060,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000639913.1",
"protein_id": "ENSP00000492241.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1208,
"cds_start": 31,
"cds_end": null,
"cds_length": 3627,
"cdna_start": 228,
"cdna_end": null,
"cdna_length": 12071,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "NM_001437423.1",
"protein_id": "NP_001424352.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1207,
"cds_start": 31,
"cds_end": null,
"cds_length": 3624,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12057,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000434208.6",
"protein_id": "ENSP00000402150.2",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1207,
"cds_start": 31,
"cds_end": null,
"cds_length": 3624,
"cdna_start": 51,
"cdna_end": null,
"cdna_length": 4055,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000640969.1",
"protein_id": "ENSP00000492200.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1207,
"cds_start": 31,
"cds_end": null,
"cds_length": 3624,
"cdna_start": 215,
"cdna_end": null,
"cdna_length": 5789,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000638514.1",
"protein_id": "ENSP00000491840.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1196,
"cds_start": 31,
"cds_end": null,
"cds_length": 3593,
"cdna_start": 169,
"cdna_end": null,
"cdna_length": 3711,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "NM_001014797.3",
"protein_id": "NP_001014797.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1182,
"cds_start": 31,
"cds_end": null,
"cds_length": 3549,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 11982,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "NM_001322836.2",
"protein_id": "NP_001309765.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1181,
"cds_start": 31,
"cds_end": null,
"cds_length": 3546,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 6096,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000638991.1",
"protein_id": "ENSP00000490978.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1181,
"cds_start": 31,
"cds_end": null,
"cds_length": 3546,
"cdna_start": 228,
"cdna_end": null,
"cdna_length": 11990,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000639489.1",
"protein_id": "ENSP00000491927.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1181,
"cds_start": 31,
"cds_end": null,
"cds_length": 3546,
"cdna_start": 184,
"cdna_end": null,
"cdna_length": 4302,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000640141.1",
"protein_id": "ENSP00000491418.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1181,
"cds_start": 31,
"cds_end": null,
"cds_length": 3546,
"cdna_start": 184,
"cdna_end": null,
"cdna_length": 5705,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "NM_001322829.2",
"protein_id": "NP_001309758.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1180,
"cds_start": 31,
"cds_end": null,
"cds_length": 3543,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 11976,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "NM_001410940.1",
"protein_id": "NP_001397869.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1178,
"cds_start": 31,
"cds_end": null,
"cds_length": 3537,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 11970,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "NM_002247.4",
"protein_id": "NP_002238.2",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1178,
"cds_start": 31,
"cds_end": null,
"cds_length": 3537,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 6087,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000639601.1",
"protein_id": "ENSP00000492806.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1178,
"cds_start": 31,
"cds_end": null,
"cds_length": 3537,
"cdna_start": 167,
"cdna_end": null,
"cdna_length": 11920,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000640834.1",
"protein_id": "ENSP00000491920.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1178,
"cds_start": 31,
"cds_end": null,
"cds_length": 3537,
"cdna_start": 147,
"cdna_end": null,
"cdna_length": 3664,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "NM_001322832.2",
"protein_id": "NP_001309761.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1177,
"cds_start": 31,
"cds_end": null,
"cds_length": 3534,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 11967,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000638306.1",
"protein_id": "ENSP00000491008.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1177,
"cds_start": 31,
"cds_end": null,
"cds_length": 3534,
"cdna_start": 184,
"cdna_end": null,
"cdna_length": 3811,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000639486.1",
"protein_id": "ENSP00000492005.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 1177,
"cds_start": 31,
"cds_end": null,
"cds_length": 3534,
"cdna_start": 402,
"cdna_end": null,
"cdna_length": 8850,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "NM_001271518.2",
"protein_id": "NP_001258447.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1128,
"cds_start": 31,
"cds_end": null,
"cds_length": 3387,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 11820,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000639120.1",
"protein_id": "ENSP00000492236.1",
"transcript_support_level": 5,
"aa_start": 11,
"aa_end": null,
"aa_length": 584,
"cds_start": 31,
"cds_end": null,
"cds_length": 1755,
"cdna_start": 140,
"cdna_end": null,
"cdna_length": 2308,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "NM_001322839.2",
"protein_id": "NP_001309768.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 245,
"cds_start": 31,
"cds_end": null,
"cds_length": 738,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 1028,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "NM_001271520.2",
"protein_id": "NP_001258449.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 213,
"cds_start": 31,
"cds_end": null,
"cds_length": 642,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 1352,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "NM_001271522.2",
"protein_id": "NP_001258451.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 168,
"cds_start": 31,
"cds_end": null,
"cds_length": 507,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 2950,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "NM_001271521.2",
"protein_id": "NP_001258450.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 128,
"cds_start": 31,
"cds_end": null,
"cds_length": 387,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 915,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "ENST00000481070.1",
"protein_id": "ENSP00000475086.1",
"transcript_support_level": 2,
"aa_start": 11,
"aa_end": null,
"aa_length": 128,
"cds_start": 31,
"cds_end": null,
"cds_length": 387,
"cdna_start": 198,
"cdna_end": null,
"cdna_length": 896,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 32,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_017016207.3",
"protein_id": "XP_016871696.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1311,
"cds_start": 31,
"cds_end": null,
"cds_length": 3936,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12369,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 32,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_017016208.3",
"protein_id": "XP_016871697.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1310,
"cds_start": 31,
"cds_end": null,
"cds_length": 3933,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12366,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_017016209.3",
"protein_id": "XP_016871698.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1307,
"cds_start": 31,
"cds_end": null,
"cds_length": 3924,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 6474,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_024447987.2",
"protein_id": "XP_024303755.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1288,
"cds_start": 31,
"cds_end": null,
"cds_length": 3867,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12170,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 31,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_011539773.3",
"protein_id": "XP_011538075.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1284,
"cds_start": 31,
"cds_end": null,
"cds_length": 3855,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12288,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 31,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_017016210.3",
"protein_id": "XP_016871699.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1283,
"cds_start": 31,
"cds_end": null,
"cds_length": 3852,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12285,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 31,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_011539774.3",
"protein_id": "XP_011538076.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1282,
"cds_start": 31,
"cds_end": null,
"cds_length": 3849,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 6399,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_011539775.3",
"protein_id": "XP_011538077.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1280,
"cds_start": 31,
"cds_end": null,
"cds_length": 3843,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12276,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_011539777.3",
"protein_id": "XP_011538079.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1267,
"cds_start": 31,
"cds_end": null,
"cds_length": 3804,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 6354,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_011539778.3",
"protein_id": "XP_011538080.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1263,
"cds_start": 31,
"cds_end": null,
"cds_length": 3792,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 6342,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_005269776.5",
"protein_id": "XP_005269833.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1257,
"cds_start": 31,
"cds_end": null,
"cds_length": 3774,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12077,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 31,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_017016211.3",
"protein_id": "XP_016871700.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1254,
"cds_start": 31,
"cds_end": null,
"cds_length": 3765,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12198,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_047425195.1",
"protein_id": "XP_047281151.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1253,
"cds_start": 31,
"cds_end": null,
"cds_length": 3762,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 6312,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_047425196.1",
"protein_id": "XP_047281152.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1251,
"cds_start": 31,
"cds_end": null,
"cds_length": 3756,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12189,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_017016213.3",
"protein_id": "XP_016871702.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1250,
"cds_start": 31,
"cds_end": null,
"cds_length": 3753,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12186,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_017016214.3",
"protein_id": "XP_016871703.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1249,
"cds_start": 31,
"cds_end": null,
"cds_length": 3750,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 6300,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_011539780.3",
"protein_id": "XP_011538082.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1240,
"cds_start": 31,
"cds_end": null,
"cds_length": 3723,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12156,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_005269778.3",
"protein_id": "XP_005269835.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1239,
"cds_start": 31,
"cds_end": null,
"cds_length": 3720,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12153,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_005269781.3",
"protein_id": "XP_005269838.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1236,
"cds_start": 31,
"cds_end": null,
"cds_length": 3711,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12144,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_024447984.2",
"protein_id": "XP_024303752.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1235,
"cds_start": 31,
"cds_end": null,
"cds_length": 3708,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12141,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_024447988.2",
"protein_id": "XP_024303756.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1234,
"cds_start": 31,
"cds_end": null,
"cds_length": 3705,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12008,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_024447989.2",
"protein_id": "XP_024303757.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1234,
"cds_start": 31,
"cds_end": null,
"cds_length": 3705,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12008,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_047425197.1",
"protein_id": "XP_047281153.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1234,
"cds_start": 31,
"cds_end": null,
"cds_length": 3705,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 6255,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_005269787.5",
"protein_id": "XP_005269844.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1230,
"cds_start": 31,
"cds_end": null,
"cds_length": 3693,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 11996,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_024447990.2",
"protein_id": "XP_024303758.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1230,
"cds_start": 31,
"cds_end": null,
"cds_length": 3693,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 11996,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_011539781.4",
"protein_id": "XP_011538083.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1226,
"cds_start": 31,
"cds_end": null,
"cds_length": 3681,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12114,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_017016217.2",
"protein_id": "XP_016871706.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1221,
"cds_start": 31,
"cds_end": null,
"cds_length": 3666,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12099,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_011539783.3",
"protein_id": "XP_011538085.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1211,
"cds_start": 31,
"cds_end": null,
"cds_length": 3636,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 6186,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_005269789.3",
"protein_id": "XP_005269846.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1209,
"cds_start": 31,
"cds_end": null,
"cds_length": 3630,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12063,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_011539785.3",
"protein_id": "XP_011538087.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1207,
"cds_start": 31,
"cds_end": null,
"cds_length": 3624,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12057,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_047425199.1",
"protein_id": "XP_047281155.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1206,
"cds_start": 31,
"cds_end": null,
"cds_length": 3621,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 12054,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_006717826.3",
"protein_id": "XP_006717889.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1205,
"cds_start": 31,
"cds_end": null,
"cds_length": 3618,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 6168,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_024447985.2",
"protein_id": "XP_024303753.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1181,
"cds_start": 31,
"cds_end": null,
"cds_length": 3546,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 11979,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_017016222.3",
"protein_id": "XP_016871711.2",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 1177,
"cds_start": 31,
"cds_end": null,
"cds_length": 3534,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 11967,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_017016219.3",
"protein_id": "XP_016871708.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 750,
"cds_start": 31,
"cds_end": null,
"cds_length": 2253,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 8144,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_011539784.3",
"protein_id": "XP_011538086.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 740,
"cds_start": 31,
"cds_end": null,
"cds_length": 2223,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 2672,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SSGGGGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del",
"transcript": "XM_047425201.1",
"protein_id": "XP_047281157.1",
"transcript_support_level": null,
"aa_start": 11,
"aa_end": null,
"aa_length": 696,
"cds_start": 31,
"cds_end": null,
"cds_length": 2091,
"cdna_start": 217,
"cdna_end": null,
"cdna_length": 2540,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 31,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.-15_6delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Gly4fs",
"transcript": "ENST00000638895.1",
"protein_id": "ENSP00000491207.1",
"transcript_support_level": 5,
"aa_start": 1,
"aa_end": null,
"aa_length": 1222,
"cds_start": 1,
"cds_end": null,
"cds_length": 3669,
"cdna_start": 7,
"cdna_end": null,
"cdna_length": 3684,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"5_prime_UTR_truncation",
"exon_loss_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 31,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.-15_6delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000638895.1",
"protein_id": "ENSP00000491207.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 1222,
"cds_start": -4,
"cds_end": null,
"cds_length": 3669,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3684,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "n.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000639483.1",
"protein_id": "ENSP00000492406.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4021,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 33,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "n.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000639968.1",
"protein_id": "ENSP00000491723.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4126,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "n.197_217delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "XR_007061964.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2428,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 32,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.-159_-139delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000372437.6",
"protein_id": "ENSP00000361514.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 1232,
"cds_start": -4,
"cds_end": null,
"cds_length": 3699,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3751,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 31,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.-15_6delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000638895.1",
"protein_id": "ENSP00000491207.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 1222,
"cds_start": -4,
"cds_end": null,
"cds_length": 3669,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3684,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 31,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.-45_-25delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000639370.1",
"protein_id": "ENSP00000491277.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 1197,
"cds_start": -4,
"cds_end": null,
"cds_length": 3594,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3624,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 31,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.-165_-145delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000639498.1",
"protein_id": "ENSP00000492835.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 1196,
"cds_start": -4,
"cds_end": null,
"cds_length": 3591,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4711,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 31,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.-165_-145delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000372408.7",
"protein_id": "ENSP00000361485.3",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 1195,
"cds_start": -4,
"cds_end": null,
"cds_length": 3588,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3805,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.-165_-145delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000372403.9",
"protein_id": "ENSP00000361480.4",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 1192,
"cds_start": -4,
"cds_end": null,
"cds_length": 3579,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3579,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.-120_-100delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000639344.1",
"protein_id": "ENSP00000492559.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 1184,
"cds_start": -4,
"cds_end": null,
"cds_length": 3555,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4073,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.-51_-31delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000372421.10",
"protein_id": "ENSP00000361498.6",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 1181,
"cds_start": -4,
"cds_end": null,
"cds_length": 3546,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3806,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 31,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.-165_-145delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000640029.1",
"protein_id": "ENSP00000491463.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 1178,
"cds_start": -4,
"cds_end": null,
"cds_length": 3537,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3537,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.-165_-145delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000640934.1",
"protein_id": "ENSP00000491539.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 1175,
"cds_start": -4,
"cds_end": null,
"cds_length": 3528,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3528,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.-45_-25delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000640773.1",
"protein_id": "ENSP00000491173.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 1159,
"cds_start": -4,
"cds_end": null,
"cds_length": 3480,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3481,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.-165_-145delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000639823.1",
"protein_id": "ENSP00000490982.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 1146,
"cds_start": -4,
"cds_end": null,
"cds_length": 3441,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3638,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.-165_-145delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000404857.6",
"protein_id": "ENSP00000385806.3",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 1142,
"cds_start": -4,
"cds_end": null,
"cds_length": 3429,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3429,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.-165_-145delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000639205.1",
"protein_id": "ENSP00000492718.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 1142,
"cds_start": -4,
"cds_end": null,
"cds_length": 3429,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8394,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.-165_-145delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000638252.1",
"protein_id": "ENSP00000492178.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 1119,
"cds_start": -4,
"cds_end": null,
"cds_length": 3360,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3360,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "c.-165_-145delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000640626.1",
"protein_id": "ENSP00000491545.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 1115,
"cds_start": -4,
"cds_end": null,
"cds_length": 3348,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3348,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "n.-129_-109delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000638506.1",
"protein_id": "ENSP00000492740.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2124,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 26,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "n.-150_-130delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000639995.1",
"protein_id": "ENSP00000491902.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3464,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"hgvs_c": "n.-165_-145delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000640093.1",
"protein_id": "ENSP00000492224.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3434,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "KCNMA1",
"gene_hgnc_id": 6284,
"dbsnp": "rs1484259264",
"frequency_reference_population": 0.00020066153,
"hom_count_reference_population": 0,
"allele_count_reference_population": 306,
"gnomad_exomes_af": 0.000207543,
"gnomad_genomes_af": 0.000138387,
"gnomad_exomes_ac": 285,
"gnomad_genomes_ac": 21,
"gnomad_exomes_homalt": 0,
"gnomad_genomes_homalt": 0,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 4.781,
"phylop100way_prediction": "Uncertain_significance",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": -1,
"acmg_classification": "Likely_benign",
"acmg_criteria": "BP3",
"acmg_by_gene": [
{
"score": -1,
"benign_score": 1,
"pathogenic_score": 0,
"criteria": [
"BP3"
],
"verdict": "Likely_benign",
"transcript": "ENST00000286628.14",
"gene_symbol": "KCNMA1",
"hgnc_id": 6284,
"effects": [
"conservative_inframe_deletion"
],
"inheritance_mode": "AR,AD",
"hgvs_c": "c.31_51delAGCAGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ser11_Gly17del"
}
],
"clinvar_disease": " and seizures, developmental delay,Cerebellar atrophy,Generalized epilepsy-paroxysmal dyskinesia syndrome,not provided",
"clinvar_classification": "Conflicting classifications of pathogenicity",
"clinvar_review_status": "criteria provided, conflicting classifications",
"clinvar_submissions_summary": "US:4 LB:1",
"phenotype_combined": "Generalized epilepsy-paroxysmal dyskinesia syndrome|not provided|Cerebellar atrophy, developmental delay, and seizures",
"pathogenicity_classification_combined": "Conflicting classifications of pathogenicity",
"custom_annotations": null
}
],
"message": null
}