← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 11-5226902-AAACCTGTCTTGTAACCTTGATACCAACCTGCCCAGGGCCTCACC-A (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=11&pos=5226902&ref=AAACCTGTCTTGTAACCTTGATACCAACCTGCCCAGGGCCTCACC&alt=A&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "11",
"pos": 5226902,
"ref": "AAACCTGTCTTGTAACCTTGATACCAACCTGCCCAGGGCCTCACC",
"alt": "A",
"effect": "frameshift_variant,splice_donor_variant,splice_region_variant,intron_variant",
"transcript": "ENST00000335295.4",
"consequences": [
{
"aa_ref": "GEALGR",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HBB",
"gene_hgnc_id": 4827,
"hgvs_c": "c.76_92+27delGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTT",
"hgvs_p": "p.Gly26fs",
"transcript": "NM_000518.5",
"protein_id": "NP_000509.1",
"transcript_support_level": null,
"aa_start": 26,
"aa_end": null,
"aa_length": 147,
"cds_start": 76,
"cds_end": null,
"cds_length": 444,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 628,
"mane_select": "ENST00000335295.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GEALGR",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HBB",
"gene_hgnc_id": 4827,
"hgvs_c": "c.76_92+27delGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTT",
"hgvs_p": "p.Gly26fs",
"transcript": "ENST00000335295.4",
"protein_id": "ENSP00000333994.3",
"transcript_support_level": 1,
"aa_start": 26,
"aa_end": null,
"aa_length": 147,
"cds_start": 76,
"cds_end": null,
"cds_length": 444,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 628,
"mane_select": "NM_000518.5",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GEALGR",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HBB",
"gene_hgnc_id": 4827,
"hgvs_c": "c.76_92+27delGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTT",
"hgvs_p": "p.Gly26fs",
"transcript": "ENST00000485743.1",
"protein_id": "ENSP00000496200.1",
"transcript_support_level": 1,
"aa_start": 26,
"aa_end": null,
"aa_length": 111,
"cds_start": 76,
"cds_end": null,
"cds_length": 336,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 680,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GEALGR",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HBB",
"gene_hgnc_id": 4827,
"hgvs_c": "c.76_92+27delGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTT",
"hgvs_p": "p.Gly26fs",
"transcript": "ENST00000647020.1",
"protein_id": "ENSP00000494175.1",
"transcript_support_level": null,
"aa_start": 26,
"aa_end": null,
"aa_length": 147,
"cds_start": 76,
"cds_end": null,
"cds_length": 444,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 754,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GEALGR",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HBB",
"gene_hgnc_id": 4827,
"hgvs_c": "c.76_92+27delGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTT",
"hgvs_p": "p.Gly26fs",
"transcript": "ENST00000380315.2",
"protein_id": "ENSP00000369671.2",
"transcript_support_level": 5,
"aa_start": 26,
"aa_end": null,
"aa_length": 89,
"cds_start": 76,
"cds_end": null,
"cds_length": 272,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 502,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"splice_donor_variant",
"splice_region_variant",
"intron_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HBB",
"gene_hgnc_id": 4827,
"hgvs_c": "n.76_76+43delGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTT",
"hgvs_p": null,
"transcript": "ENST00000633227.1",
"protein_id": "ENSP00000488004.1",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 609,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "ENSG00000298932",
"gene_hgnc_id": null,
"hgvs_c": "n.265+1175_265+1218delAACCTGTCTTGTAACCTTGATACCAACCTGCCCAGGGCCTCACC",
"hgvs_p": null,
"transcript": "ENST00000759072.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 336,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HBB",
"gene_hgnc_id": 4827,
"hgvs_c": "n.-123_-80delGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTT",
"hgvs_p": null,
"transcript": "ENST00000475226.1",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 319,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "HBB",
"gene_hgnc_id": 4827,
"dbsnp": "rs63751076",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 0.304,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 10,
"acmg_classification": "Pathogenic",
"acmg_criteria": "PVS1,PP5_Moderate",
"acmg_by_gene": [
{
"score": 10,
"benign_score": 0,
"pathogenic_score": 10,
"criteria": [
"PVS1",
"PP5_Moderate"
],
"verdict": "Pathogenic",
"transcript": "ENST00000335295.4",
"gene_symbol": "HBB",
"hgnc_id": 4827,
"effects": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"inheritance_mode": "AR,AD,SD",
"hgvs_c": "c.76_92+27delGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTT",
"hgvs_p": "p.Gly26fs"
},
{
"score": 2,
"benign_score": 0,
"pathogenic_score": 2,
"criteria": [
"PP5_Moderate"
],
"verdict": "Uncertain_significance",
"transcript": "ENST00000759072.1",
"gene_symbol": "ENSG00000298932",
"hgnc_id": null,
"effects": [
"intron_variant"
],
"inheritance_mode": "",
"hgvs_c": "n.265+1175_265+1218delAACCTGTCTTGTAACCTTGATACCAACCTGCCCAGGGCCTCACC",
"hgvs_p": null
}
],
"clinvar_disease": "Beta zero thalassemia,Hemoglobinopathy,beta Thalassemia",
"clinvar_classification": "Likely pathogenic",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "LP:1",
"phenotype_combined": "Beta zero thalassemia|Hemoglobinopathy|beta Thalassemia",
"pathogenicity_classification_combined": "Likely pathogenic",
"custom_annotations": null
}
],
"message": null
}