← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 11-6390705-T-TGGCGCTGGCGCTGGCGCTGGCGCTGGC (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=11&pos=6390705&ref=T&alt=TGGCGCTGGCGCTGGCGCTGGCGCTGGC&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "11",
      "pos": 6390705,
      "ref": "T",
      "alt": "TGGCGCTGGCGCTGGCGCTGGCGCTGGC",
      "effect": "conservative_inframe_insertion",
      "transcript": "ENST00000342245.9",
      "consequences": [
        {
          "aa_ref": "L",
          "aa_alt": "ALALALALAL",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "conservative_inframe_insertion"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "SMPD1",
          "gene_hgnc_id": 11120,
          "hgvs_c": "c.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCG",
          "hgvs_p": "p.Val36_Leu37insAlaLeuAlaLeuAlaLeuAlaLeuAla",
          "transcript": "NM_000543.5",
          "protein_id": "NP_000534.3",
          "transcript_support_level": null,
          "aa_start": 37,
          "aa_end": null,
          "aa_length": 631,
          "cds_start": 109,
          "cds_end": null,
          "cds_length": 1896,
          "cdna_start": 234,
          "cdna_end": null,
          "cdna_length": 2410,
          "mane_select": "ENST00000342245.9",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "L",
          "aa_alt": "ALALALALAL",
          "canonical": true,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "conservative_inframe_insertion"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "SMPD1",
          "gene_hgnc_id": 11120,
          "hgvs_c": "c.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCG",
          "hgvs_p": "p.Val36_Leu37insAlaLeuAlaLeuAlaLeuAlaLeuAla",
          "transcript": "ENST00000342245.9",
          "protein_id": "ENSP00000340409.4",
          "transcript_support_level": 1,
          "aa_start": 37,
          "aa_end": null,
          "aa_length": 631,
          "cds_start": 109,
          "cds_end": null,
          "cds_length": 1896,
          "cdna_start": 234,
          "cdna_end": null,
          "cdna_length": 2410,
          "mane_select": "NM_000543.5",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "SMPD1",
          "gene_hgnc_id": 11120,
          "hgvs_c": "n.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCG",
          "hgvs_p": null,
          "transcript": "ENST00000531303.5",
          "protein_id": "ENSP00000432625.1",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1451,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "SMPD1",
          "gene_hgnc_id": 11120,
          "hgvs_c": "n.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCG",
          "hgvs_p": null,
          "transcript": "ENST00000533123.5",
          "protein_id": "ENSP00000435950.1",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2211,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "SMPD1",
          "gene_hgnc_id": 11120,
          "hgvs_c": "n.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCG",
          "hgvs_p": null,
          "transcript": "ENST00000534405.5",
          "protein_id": "ENSP00000434353.1",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2446,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "L",
          "aa_alt": "ALALALALAL",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "conservative_inframe_insertion"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "SMPD1",
          "gene_hgnc_id": 11120,
          "hgvs_c": "c.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCG",
          "hgvs_p": "p.Val36_Leu37insAlaLeuAlaLeuAlaLeuAlaLeuAla",
          "transcript": "NM_001007593.3",
          "protein_id": "NP_001007594.2",
          "transcript_support_level": null,
          "aa_start": 37,
          "aa_end": null,
          "aa_length": 630,
          "cds_start": 109,
          "cds_end": null,
          "cds_length": 1893,
          "cdna_start": 234,
          "cdna_end": null,
          "cdna_length": 2407,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "L",
          "aa_alt": "ALALALALAL",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "conservative_inframe_insertion"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "SMPD1",
          "gene_hgnc_id": 11120,
          "hgvs_c": "c.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCG",
          "hgvs_p": "p.Val36_Leu37insAlaLeuAlaLeuAlaLeuAlaLeuAla",
          "transcript": "ENST00000527275.5",
          "protein_id": "ENSP00000435350.1",
          "transcript_support_level": 2,
          "aa_start": 37,
          "aa_end": null,
          "aa_length": 630,
          "cds_start": 109,
          "cds_end": null,
          "cds_length": 1893,
          "cdna_start": 233,
          "cdna_end": null,
          "cdna_length": 2188,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "L",
          "aa_alt": "ALALALALAL",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "conservative_inframe_insertion"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "SMPD1",
          "gene_hgnc_id": 11120,
          "hgvs_c": "c.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCG",
          "hgvs_p": "p.Val36_Leu37insAlaLeuAlaLeuAlaLeuAlaLeuAla",
          "transcript": "NM_001365135.2",
          "protein_id": "NP_001352064.1",
          "transcript_support_level": null,
          "aa_start": 37,
          "aa_end": null,
          "aa_length": 587,
          "cds_start": 109,
          "cds_end": null,
          "cds_length": 1764,
          "cdna_start": 234,
          "cdna_end": null,
          "cdna_length": 2278,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "L",
          "aa_alt": "ALALALALAL",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "conservative_inframe_insertion"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "SMPD1",
          "gene_hgnc_id": 11120,
          "hgvs_c": "c.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCG",
          "hgvs_p": "p.Val36_Leu37insAlaLeuAlaLeuAlaLeuAlaLeuAla",
          "transcript": "NM_001318087.2",
          "protein_id": "NP_001305016.1",
          "transcript_support_level": null,
          "aa_start": 37,
          "aa_end": null,
          "aa_length": 508,
          "cds_start": 109,
          "cds_end": null,
          "cds_length": 1527,
          "cdna_start": 234,
          "cdna_end": null,
          "cdna_length": 2430,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "L",
          "aa_alt": "ALALALALAL",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "conservative_inframe_insertion"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "SMPD1",
          "gene_hgnc_id": 11120,
          "hgvs_c": "c.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCG",
          "hgvs_p": "p.Val36_Leu37insAlaLeuAlaLeuAlaLeuAlaLeuAla",
          "transcript": "XM_011520304.3",
          "protein_id": "XP_011518606.1",
          "transcript_support_level": null,
          "aa_start": 37,
          "aa_end": null,
          "aa_length": 464,
          "cds_start": 109,
          "cds_end": null,
          "cds_length": 1395,
          "cdna_start": 234,
          "cdna_end": null,
          "cdna_length": 2298,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 2,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "SMPD1",
          "gene_hgnc_id": 11120,
          "hgvs_c": "n.267_268insGCGCTGGCGCTGGCGCTGGCGCTGGCG",
          "hgvs_p": null,
          "transcript": "ENST00000533196.1",
          "protein_id": null,
          "transcript_support_level": 3,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 425,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "SMPD1",
          "gene_hgnc_id": 11120,
          "hgvs_c": "n.233_234insGCGCTGGCGCTGGCGCTGGCGCTGGCG",
          "hgvs_p": null,
          "transcript": "NR_027400.3",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2238,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "SMPD1",
          "gene_hgnc_id": 11120,
          "hgvs_c": "n.233_234insGCGCTGGCGCTGGCGCTGGCGCTGGCG",
          "hgvs_p": null,
          "transcript": "NR_134502.2",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1777,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "SMPD1",
          "gene_hgnc_id": 11120,
          "hgvs_c": "c.-854_-853insGCGCTGGCGCTGGCGCTGGCGCTGGCG",
          "hgvs_p": null,
          "transcript": "NM_001318088.2",
          "protein_id": "NP_001305017.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 324,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 975,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2450,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 2,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "SMPD1",
          "gene_hgnc_id": 11120,
          "hgvs_c": "c.-96+67_-96+68insGCGCTGGCGCTGGCGCTGGCGCTGGCG",
          "hgvs_p": null,
          "transcript": "ENST00000530395.1",
          "protein_id": "ENSP00000431479.1",
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 51,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 158,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 447,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "SMPD1",
      "gene_hgnc_id": 11120,
      "dbsnp": "rs775568984",
      "frequency_reference_population": 0.000013572757,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 2,
      "gnomad_exomes_af": 0.00000345362,
      "gnomad_genomes_af": 0.0000135728,
      "gnomad_exomes_ac": 5,
      "gnomad_genomes_ac": 2,
      "gnomad_exomes_homalt": 0,
      "gnomad_genomes_homalt": 0,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": -0.158,
      "phylop100way_prediction": "Benign",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 1,
      "acmg_classification": "Uncertain_significance",
      "acmg_criteria": "PM1,BP3",
      "acmg_by_gene": [
        {
          "score": 1,
          "benign_score": 1,
          "pathogenic_score": 2,
          "criteria": [
            "PM1",
            "BP3"
          ],
          "verdict": "Uncertain_significance",
          "transcript": "ENST00000342245.9",
          "gene_symbol": "SMPD1",
          "hgnc_id": 11120,
          "effects": [
            "conservative_inframe_insertion"
          ],
          "inheritance_mode": "AR",
          "hgvs_c": "c.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCG",
          "hgvs_p": "p.Val36_Leu37insAlaLeuAlaLeuAlaLeuAlaLeuAla"
        }
      ],
      "clinvar_disease": "",
      "clinvar_classification": "",
      "clinvar_review_status": "",
      "clinvar_submissions_summary": "",
      "phenotype_combined": null,
      "pathogenicity_classification_combined": null,
      "custom_annotations": null
    }
  ],
  "message": null
}