← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 11-6390705-T-TGGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGC (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=11&pos=6390705&ref=T&alt=TGGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGC&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "11",
"pos": 6390705,
"ref": "T",
"alt": "TGGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGC",
"effect": "conservative_inframe_insertion",
"transcript": "ENST00000342245.9",
"consequences": [
{
"aa_ref": "L",
"aa_alt": "ALALALALALAL",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SMPD1",
"gene_hgnc_id": 11120,
"hgvs_c": "c.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCG",
"hgvs_p": "p.Val36_Leu37insAlaLeuAlaLeuAlaLeuAlaLeuAlaLeuAla",
"transcript": "NM_000543.5",
"protein_id": "NP_000534.3",
"transcript_support_level": null,
"aa_start": 37,
"aa_end": null,
"aa_length": 631,
"cds_start": 109,
"cds_end": null,
"cds_length": 1896,
"cdna_start": 234,
"cdna_end": null,
"cdna_length": 2410,
"mane_select": "ENST00000342245.9",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "L",
"aa_alt": "ALALALALALAL",
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SMPD1",
"gene_hgnc_id": 11120,
"hgvs_c": "c.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCG",
"hgvs_p": "p.Val36_Leu37insAlaLeuAlaLeuAlaLeuAlaLeuAlaLeuAla",
"transcript": "ENST00000342245.9",
"protein_id": "ENSP00000340409.4",
"transcript_support_level": 1,
"aa_start": 37,
"aa_end": null,
"aa_length": 631,
"cds_start": 109,
"cds_end": null,
"cds_length": 1896,
"cdna_start": 234,
"cdna_end": null,
"cdna_length": 2410,
"mane_select": "NM_000543.5",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SMPD1",
"gene_hgnc_id": 11120,
"hgvs_c": "n.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCG",
"hgvs_p": null,
"transcript": "ENST00000531303.5",
"protein_id": "ENSP00000432625.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1451,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SMPD1",
"gene_hgnc_id": 11120,
"hgvs_c": "n.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCG",
"hgvs_p": null,
"transcript": "ENST00000533123.5",
"protein_id": "ENSP00000435950.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2211,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SMPD1",
"gene_hgnc_id": 11120,
"hgvs_c": "n.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCG",
"hgvs_p": null,
"transcript": "ENST00000534405.5",
"protein_id": "ENSP00000434353.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2446,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "L",
"aa_alt": "ALALALALALAL",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SMPD1",
"gene_hgnc_id": 11120,
"hgvs_c": "c.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCG",
"hgvs_p": "p.Val36_Leu37insAlaLeuAlaLeuAlaLeuAlaLeuAlaLeuAla",
"transcript": "NM_001007593.3",
"protein_id": "NP_001007594.2",
"transcript_support_level": null,
"aa_start": 37,
"aa_end": null,
"aa_length": 630,
"cds_start": 109,
"cds_end": null,
"cds_length": 1893,
"cdna_start": 234,
"cdna_end": null,
"cdna_length": 2407,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "L",
"aa_alt": "ALALALALALAL",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SMPD1",
"gene_hgnc_id": 11120,
"hgvs_c": "c.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCG",
"hgvs_p": "p.Val36_Leu37insAlaLeuAlaLeuAlaLeuAlaLeuAlaLeuAla",
"transcript": "ENST00000527275.5",
"protein_id": "ENSP00000435350.1",
"transcript_support_level": 2,
"aa_start": 37,
"aa_end": null,
"aa_length": 630,
"cds_start": 109,
"cds_end": null,
"cds_length": 1893,
"cdna_start": 233,
"cdna_end": null,
"cdna_length": 2188,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "L",
"aa_alt": "ALALALALALAL",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SMPD1",
"gene_hgnc_id": 11120,
"hgvs_c": "c.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCG",
"hgvs_p": "p.Val36_Leu37insAlaLeuAlaLeuAlaLeuAlaLeuAlaLeuAla",
"transcript": "NM_001365135.2",
"protein_id": "NP_001352064.1",
"transcript_support_level": null,
"aa_start": 37,
"aa_end": null,
"aa_length": 587,
"cds_start": 109,
"cds_end": null,
"cds_length": 1764,
"cdna_start": 234,
"cdna_end": null,
"cdna_length": 2278,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "L",
"aa_alt": "ALALALALALAL",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SMPD1",
"gene_hgnc_id": 11120,
"hgvs_c": "c.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCG",
"hgvs_p": "p.Val36_Leu37insAlaLeuAlaLeuAlaLeuAlaLeuAlaLeuAla",
"transcript": "NM_001318087.2",
"protein_id": "NP_001305016.1",
"transcript_support_level": null,
"aa_start": 37,
"aa_end": null,
"aa_length": 508,
"cds_start": 109,
"cds_end": null,
"cds_length": 1527,
"cdna_start": 234,
"cdna_end": null,
"cdna_length": 2430,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "L",
"aa_alt": "ALALALALALAL",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SMPD1",
"gene_hgnc_id": 11120,
"hgvs_c": "c.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCG",
"hgvs_p": "p.Val36_Leu37insAlaLeuAlaLeuAlaLeuAlaLeuAlaLeuAla",
"transcript": "XM_011520304.3",
"protein_id": "XP_011518606.1",
"transcript_support_level": null,
"aa_start": 37,
"aa_end": null,
"aa_length": 464,
"cds_start": 109,
"cds_end": null,
"cds_length": 1395,
"cdna_start": 234,
"cdna_end": null,
"cdna_length": 2298,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SMPD1",
"gene_hgnc_id": 11120,
"hgvs_c": "n.267_268insGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCG",
"hgvs_p": null,
"transcript": "ENST00000533196.1",
"protein_id": null,
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 425,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SMPD1",
"gene_hgnc_id": 11120,
"hgvs_c": "n.233_234insGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCG",
"hgvs_p": null,
"transcript": "NR_027400.3",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2238,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SMPD1",
"gene_hgnc_id": 11120,
"hgvs_c": "n.233_234insGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCG",
"hgvs_p": null,
"transcript": "NR_134502.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1777,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SMPD1",
"gene_hgnc_id": 11120,
"hgvs_c": "c.-854_-853insGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCG",
"hgvs_p": null,
"transcript": "NM_001318088.2",
"protein_id": "NP_001305017.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 324,
"cds_start": -4,
"cds_end": null,
"cds_length": 975,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2450,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "SMPD1",
"gene_hgnc_id": 11120,
"hgvs_c": "c.-96+67_-96+68insGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCG",
"hgvs_p": null,
"transcript": "ENST00000530395.1",
"protein_id": "ENSP00000431479.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 51,
"cds_start": -4,
"cds_end": null,
"cds_length": 158,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 447,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "SMPD1",
"gene_hgnc_id": 11120,
"dbsnp": "rs775568984",
"frequency_reference_population": 0.0000067921865,
"hom_count_reference_population": 0,
"allele_count_reference_population": 1,
"gnomad_exomes_af": 0.00000828869,
"gnomad_genomes_af": 0.00000679219,
"gnomad_exomes_ac": 12,
"gnomad_genomes_ac": 1,
"gnomad_exomes_homalt": 0,
"gnomad_genomes_homalt": 0,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": -0.158,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 1,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "PM1,BP3",
"acmg_by_gene": [
{
"score": 1,
"benign_score": 1,
"pathogenic_score": 2,
"criteria": [
"PM1",
"BP3"
],
"verdict": "Uncertain_significance",
"transcript": "ENST00000342245.9",
"gene_symbol": "SMPD1",
"hgnc_id": 11120,
"effects": [
"conservative_inframe_insertion"
],
"inheritance_mode": "AR",
"hgvs_c": "c.108_109insGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCG",
"hgvs_p": "p.Val36_Leu37insAlaLeuAlaLeuAlaLeuAlaLeuAlaLeuAla"
}
],
"clinvar_disease": "",
"clinvar_classification": "",
"clinvar_review_status": "",
"clinvar_submissions_summary": "",
"phenotype_combined": null,
"pathogenicity_classification_combined": null,
"custom_annotations": null
}
],
"message": null
}