← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 11-66510645-ACGACGCCTGCGAAGATGGCCGCTGCGTCCTCATCGGATTC-A (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=11&pos=66510645&ref=ACGACGCCTGCGAAGATGGCCGCTGCGTCCTCATCGGATTC&alt=A&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "11",
"pos": 66510645,
"ref": "ACGACGCCTGCGAAGATGGCCGCTGCGTCCTCATCGGATTC",
"alt": "A",
"effect": "frameshift_variant,start_lost",
"transcript": "ENST00000318312.12",
"consequences": [
{
"aa_ref": "MAAASSSDSDACG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant",
"start_lost"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": "p.Met1fs",
"transcript": "NM_024649.5",
"protein_id": "NP_078925.3",
"transcript_support_level": null,
"aa_start": 1,
"aa_end": null,
"aa_length": 593,
"cds_start": 1,
"cds_end": null,
"cds_length": 1782,
"cdna_start": 23,
"cdna_end": null,
"cdna_length": 3368,
"mane_select": "ENST00000318312.12",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "MAAASSSDSDACG",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant",
"start_lost"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": "p.Met1fs",
"transcript": "ENST00000318312.12",
"protein_id": "ENSP00000317469.7",
"transcript_support_level": 1,
"aa_start": 1,
"aa_end": null,
"aa_length": 593,
"cds_start": 1,
"cds_end": null,
"cds_length": 1782,
"cdna_start": 23,
"cdna_end": null,
"cdna_length": 3368,
"mane_select": "NM_024649.5",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "MAAASSSDSDACG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant",
"start_lost"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": "p.Met1fs",
"transcript": "ENST00000393994.4",
"protein_id": "ENSP00000377563.2",
"transcript_support_level": 1,
"aa_start": 1,
"aa_end": null,
"aa_length": 446,
"cds_start": 1,
"cds_end": null,
"cds_length": 1341,
"cdna_start": 3,
"cdna_end": null,
"cdna_length": 1790,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "n.16_55delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000529955.5",
"protein_id": null,
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3437,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "NM_024649.5",
"protein_id": "NP_078925.3",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 593,
"cds_start": -4,
"cds_end": null,
"cds_length": 1782,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3368,
"mane_select": "ENST00000318312.12",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000318312.12",
"protein_id": "ENSP00000317469.7",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 593,
"cds_start": -4,
"cds_end": null,
"cds_length": 1782,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3368,
"mane_select": "NM_024649.5",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000393994.4",
"protein_id": "ENSP00000377563.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 446,
"cds_start": -4,
"cds_end": null,
"cds_length": 1341,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1790,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "ENSG00000256349",
"gene_hgnc_id": null,
"hgvs_c": "c.159-356_159-317delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000419755.3",
"protein_id": "ENSP00000398526.3",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 630,
"cds_start": -4,
"cds_end": null,
"cds_length": 1893,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3547,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "MAAASSSDSDACG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant",
"start_lost"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": "p.Met1fs",
"transcript": "ENST00000455748.6",
"protein_id": "ENSP00000405764.2",
"transcript_support_level": 2,
"aa_start": 1,
"aa_end": null,
"aa_length": 496,
"cds_start": 1,
"cds_end": null,
"cds_length": 1491,
"cdna_start": 16,
"cdna_end": null,
"cdna_length": 1552,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "MAAASSSDSDACG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant",
"start_lost"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": "p.Met1fs",
"transcript": "ENST00000525809.5",
"protein_id": "ENSP00000431187.1",
"transcript_support_level": 5,
"aa_start": 1,
"aa_end": null,
"aa_length": 191,
"cds_start": 1,
"cds_end": null,
"cds_length": 577,
"cdna_start": 22,
"cdna_end": null,
"cdna_length": 601,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "MAAASSSDSDACG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant",
"start_lost"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": "p.Met1fs",
"transcript": "ENST00000630659.2",
"protein_id": "ENSP00000486455.1",
"transcript_support_level": 5,
"aa_start": 1,
"aa_end": null,
"aa_length": 85,
"cds_start": 1,
"cds_end": null,
"cds_length": 258,
"cdna_start": 3,
"cdna_end": null,
"cdna_length": 1934,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "n.-13_27delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000524907.5",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 828,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "n.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000526035.5",
"protein_id": "ENSP00000434197.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 822,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "n.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000526760.5",
"protein_id": "ENSP00000432140.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3585,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "n.-399_-360delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000527251.5",
"protein_id": "ENSP00000434360.1",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1034,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "n.5_44delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000529766.5",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1590,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "n.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000532908.5",
"protein_id": "ENSP00000431866.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1001,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "n.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000533557.5",
"protein_id": "ENSP00000434619.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1043,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "n.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000533644.5",
"protein_id": "ENSP00000436073.1",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 910,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "n.10_49delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000534730.5",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 627,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000455748.6",
"protein_id": "ENSP00000405764.2",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 496,
"cds_start": -4,
"cds_end": null,
"cds_length": 1491,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1552,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000525809.5",
"protein_id": "ENSP00000431187.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 191,
"cds_start": -4,
"cds_end": null,
"cds_length": 577,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 601,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000630659.2",
"protein_id": "ENSP00000486455.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 85,
"cds_start": -4,
"cds_end": null,
"cds_length": 258,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1934,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "c.-399_-360delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000526815.5",
"protein_id": "ENSP00000436860.1",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": 53,
"cds_start": -4,
"cds_end": null,
"cds_length": 162,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 584,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "n.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000526035.5",
"protein_id": "ENSP00000434197.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 822,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "n.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000526760.5",
"protein_id": "ENSP00000432140.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3585,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "n.-399_-360delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000527251.5",
"protein_id": "ENSP00000434360.1",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1034,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "n.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000532908.5",
"protein_id": "ENSP00000431866.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1001,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "n.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000533557.5",
"protein_id": "ENSP00000434619.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1043,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "n.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null,
"transcript": "ENST00000533644.5",
"protein_id": "ENSP00000436073.1",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 910,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "c.-14_26delCGACGCCTGCGAAGATGGCCGCTGCGTCCTCATCGGATTC",
"hgvs_p": null,
"transcript": "ENST00000393994.4",
"protein_id": "ENSP00000377563.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 446,
"cds_start": -4,
"cds_end": null,
"cds_length": 1341,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1790,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "c.-14_26delCGACGCCTGCGAAGATGGCCGCTGCGTCCTCATCGGATTC",
"hgvs_p": null,
"transcript": "ENST00000630659.2",
"protein_id": "ENSP00000486455.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 85,
"cds_start": -4,
"cds_end": null,
"cds_length": 258,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1934,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "n.-24_16delCGACGCCTGCGAAGATGGCCGCTGCGTCCTCATCGGATTC",
"hgvs_p": null,
"transcript": "ENST00000524907.5",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 828,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "n.-7_33delCGACGCCTGCGAAGATGGCCGCTGCGTCCTCATCGGATTC",
"hgvs_p": null,
"transcript": "ENST00000529766.5",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1590,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "n.-14_26delCGACGCCTGCGAAGATGGCCGCTGCGTCCTCATCGGATTC",
"hgvs_p": null,
"transcript": "ENST00000532908.5",
"protein_id": "ENSP00000431866.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1001,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"hgvs_c": "n.-2_38delCGACGCCTGCGAAGATGGCCGCTGCGTCCTCATCGGATTC",
"hgvs_p": null,
"transcript": "ENST00000534730.5",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 627,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "BBS1",
"gene_hgnc_id": 966,
"dbsnp": "rs113994178",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 3.908,
"phylop100way_prediction": "Uncertain_significance",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 12,
"acmg_classification": "Pathogenic",
"acmg_criteria": "PVS1,PS1_Moderate,PP5_Moderate",
"acmg_by_gene": [
{
"score": 12,
"benign_score": 0,
"pathogenic_score": 12,
"criteria": [
"PVS1",
"PS1_Moderate",
"PP5_Moderate"
],
"verdict": "Pathogenic",
"transcript": "ENST00000318312.12",
"gene_symbol": "BBS1",
"hgnc_id": 966,
"effects": [
"frameshift_variant",
"start_lost"
],
"inheritance_mode": "AR",
"hgvs_c": "c.-3_37delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": "p.Met1fs"
},
{
"score": 2,
"benign_score": 0,
"pathogenic_score": 2,
"criteria": [
"PP5_Moderate"
],
"verdict": "Uncertain_significance",
"transcript": "ENST00000419755.3",
"gene_symbol": "ENSG00000256349",
"hgnc_id": null,
"effects": [
"intron_variant"
],
"inheritance_mode": "",
"hgvs_c": "c.159-356_159-317delAAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG",
"hgvs_p": null
}
],
"clinvar_disease": "Bardet-Biedl syndrome",
"clinvar_classification": "Pathogenic",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "P:1",
"phenotype_combined": "Bardet-Biedl syndrome",
"pathogenicity_classification_combined": "Pathogenic",
"custom_annotations": null
}
],
"message": null
}