← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 11-72225070-CGGCCGCGGAGGAGCTGCTGGCCCGGGCG-C (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=11&pos=72225070&ref=CGGCCGCGGAGGAGCTGCTGGCCCGGGCG&alt=C&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "11",
"pos": 72225070,
"ref": "CGGCCGCGGAGGAGCTGCTGGCCCGGGCG",
"alt": "C",
"effect": "frameshift_variant",
"transcript": "ENST00000298229.7",
"consequences": [
{
"aa_ref": "EELLARAGRD",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "INPPL1",
"gene_hgnc_id": 6080,
"hgvs_c": "c.94_121delGAGGAGCTGCTGGCCCGGGCGGGCCGCG",
"hgvs_p": "p.Glu32fs",
"transcript": "NM_001567.4",
"protein_id": "NP_001558.3",
"transcript_support_level": null,
"aa_start": 32,
"aa_end": null,
"aa_length": 1258,
"cds_start": 94,
"cds_end": null,
"cds_length": 3777,
"cdna_start": 312,
"cdna_end": null,
"cdna_length": 4789,
"mane_select": "ENST00000298229.7",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EELLARAGRD",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "INPPL1",
"gene_hgnc_id": 6080,
"hgvs_c": "c.94_121delGAGGAGCTGCTGGCCCGGGCGGGCCGCG",
"hgvs_p": "p.Glu32fs",
"transcript": "ENST00000298229.7",
"protein_id": "ENSP00000298229.2",
"transcript_support_level": 1,
"aa_start": 32,
"aa_end": null,
"aa_length": 1258,
"cds_start": 94,
"cds_end": null,
"cds_length": 3777,
"cdna_start": 312,
"cdna_end": null,
"cdna_length": 4789,
"mane_select": "NM_001567.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EELLARAGRD",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "INPPL1",
"gene_hgnc_id": 6080,
"hgvs_c": "c.94_121delGAGGAGCTGCTGGCCCGGGCGGGCCGCG",
"hgvs_p": "p.Glu32fs",
"transcript": "NM_001440434.1",
"protein_id": "NP_001427363.1",
"transcript_support_level": null,
"aa_start": 32,
"aa_end": null,
"aa_length": 1280,
"cds_start": 94,
"cds_end": null,
"cds_length": 3843,
"cdna_start": 312,
"cdna_end": null,
"cdna_length": 4855,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EELLARAGRD",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "INPPL1",
"gene_hgnc_id": 6080,
"hgvs_c": "c.94_121delGAGGAGCTGCTGGCCCGGGCGGGCCGCG",
"hgvs_p": "p.Glu32fs",
"transcript": "NM_001440435.1",
"protein_id": "NP_001427364.1",
"transcript_support_level": null,
"aa_start": 32,
"aa_end": null,
"aa_length": 1258,
"cds_start": 94,
"cds_end": null,
"cds_length": 3777,
"cdna_start": 366,
"cdna_end": null,
"cdna_length": 4843,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EELLARAGRD",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "INPPL1",
"gene_hgnc_id": 6080,
"hgvs_c": "c.94_121delGAGGAGCTGCTGGCCCGGGCGGGCCGCG",
"hgvs_p": "p.Glu32fs",
"transcript": "NM_001440436.1",
"protein_id": "NP_001427365.1",
"transcript_support_level": null,
"aa_start": 32,
"aa_end": null,
"aa_length": 1258,
"cds_start": 94,
"cds_end": null,
"cds_length": 3777,
"cdna_start": 540,
"cdna_end": null,
"cdna_length": 5017,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EELLARAGRD",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "INPPL1",
"gene_hgnc_id": 6080,
"hgvs_c": "c.94_121delGAGGAGCTGCTGGCCCGGGCGGGCCGCG",
"hgvs_p": "p.Glu32fs",
"transcript": "NM_001440437.1",
"protein_id": "NP_001427366.1",
"transcript_support_level": null,
"aa_start": 32,
"aa_end": null,
"aa_length": 1211,
"cds_start": 94,
"cds_end": null,
"cds_length": 3636,
"cdna_start": 312,
"cdna_end": null,
"cdna_length": 4648,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EELLARAGRD",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "INPPL1",
"gene_hgnc_id": 6080,
"hgvs_c": "c.94_121delGAGGAGCTGCTGGCCCGGGCGGGCCGCG",
"hgvs_p": "p.Glu32fs",
"transcript": "NM_001440438.1",
"protein_id": "NP_001427367.1",
"transcript_support_level": null,
"aa_start": 32,
"aa_end": null,
"aa_length": 1184,
"cds_start": 94,
"cds_end": null,
"cds_length": 3555,
"cdna_start": 590,
"cdna_end": null,
"cdna_length": 4933,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EELLARAGRD",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "INPPL1",
"gene_hgnc_id": 6080,
"hgvs_c": "c.94_121delGAGGAGCTGCTGGCCCGGGCGGGCCGCG",
"hgvs_p": "p.Glu32fs",
"transcript": "XM_005273979.5",
"protein_id": "XP_005274036.1",
"transcript_support_level": null,
"aa_start": 32,
"aa_end": null,
"aa_length": 1280,
"cds_start": 94,
"cds_end": null,
"cds_length": 3843,
"cdna_start": 366,
"cdna_end": null,
"cdna_length": 4909,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EELLARAGRD",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "INPPL1",
"gene_hgnc_id": 6080,
"hgvs_c": "c.94_121delGAGGAGCTGCTGGCCCGGGCGGGCCGCG",
"hgvs_p": "p.Glu32fs",
"transcript": "XM_047426887.1",
"protein_id": "XP_047282843.1",
"transcript_support_level": null,
"aa_start": 32,
"aa_end": null,
"aa_length": 1280,
"cds_start": 94,
"cds_end": null,
"cds_length": 3843,
"cdna_start": 590,
"cdna_end": null,
"cdna_length": 5133,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EELLARAGRD",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "INPPL1",
"gene_hgnc_id": 6080,
"hgvs_c": "c.94_121delGAGGAGCTGCTGGCCCGGGCGGGCCGCG",
"hgvs_p": "p.Glu32fs",
"transcript": "XM_047426888.1",
"protein_id": "XP_047282844.1",
"transcript_support_level": null,
"aa_start": 32,
"aa_end": null,
"aa_length": 1280,
"cds_start": 94,
"cds_end": null,
"cds_length": 3843,
"cdna_start": 540,
"cdna_end": null,
"cdna_length": 5083,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EELLARAGRD",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "INPPL1",
"gene_hgnc_id": 6080,
"hgvs_c": "c.94_121delGAGGAGCTGCTGGCCCGGGCGGGCCGCG",
"hgvs_p": "p.Glu32fs",
"transcript": "XM_047426889.1",
"protein_id": "XP_047282845.1",
"transcript_support_level": null,
"aa_start": 32,
"aa_end": null,
"aa_length": 1280,
"cds_start": 94,
"cds_end": null,
"cds_length": 3843,
"cdna_start": 694,
"cdna_end": null,
"cdna_length": 5237,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EELLARAGRD",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "INPPL1",
"gene_hgnc_id": 6080,
"hgvs_c": "c.94_121delGAGGAGCTGCTGGCCCGGGCGGGCCGCG",
"hgvs_p": "p.Glu32fs",
"transcript": "XM_047426891.1",
"protein_id": "XP_047282847.1",
"transcript_support_level": null,
"aa_start": 32,
"aa_end": null,
"aa_length": 1206,
"cds_start": 94,
"cds_end": null,
"cds_length": 3621,
"cdna_start": 366,
"cdna_end": null,
"cdna_length": 4775,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EELLARAGRD",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "INPPL1",
"gene_hgnc_id": 6080,
"hgvs_c": "c.94_121delGAGGAGCTGCTGGCCCGGGCGGGCCGCG",
"hgvs_p": "p.Glu32fs",
"transcript": "XM_047426892.1",
"protein_id": "XP_047282848.1",
"transcript_support_level": null,
"aa_start": 32,
"aa_end": null,
"aa_length": 1184,
"cds_start": 94,
"cds_end": null,
"cds_length": 3555,
"cdna_start": 366,
"cdna_end": null,
"cdna_length": 4709,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "INPPL1",
"gene_hgnc_id": 6080,
"hgvs_c": "n.10_37delGAGGAGCTGCTGGCCCGGGCGGGCCGCG",
"hgvs_p": null,
"transcript": "ENST00000541544.1",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 530,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "INPPL1",
"gene_hgnc_id": 6080,
"hgvs_c": "c.*20_*47delGGCCGCGGAGGAGCTGCTGGCCCGGGCG",
"hgvs_p": null,
"transcript": "ENST00000540973.1",
"protein_id": "ENSP00000440904.1",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": 21,
"cds_start": -4,
"cds_end": null,
"cds_length": 67,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 375,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "INPPL1",
"gene_hgnc_id": 6080,
"hgvs_c": "c.*34_*61delGGCCGCGGAGGAGCTGCTGGCCCGGGCG",
"hgvs_p": null,
"transcript": "ENST00000543234.1",
"protein_id": "ENSP00000440512.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 16,
"cds_start": -4,
"cds_end": null,
"cds_length": 53,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 275,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "INPPL1",
"gene_hgnc_id": 6080,
"dbsnp": "rs797044470",
"frequency_reference_population": 0.000006582152,
"hom_count_reference_population": 0,
"allele_count_reference_population": 1,
"gnomad_exomes_af": null,
"gnomad_genomes_af": 0.00000658215,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": 1,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": 0,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 6.8,
"phylop100way_prediction": "Uncertain_significance",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 16,
"acmg_classification": "Pathogenic",
"acmg_criteria": "PVS1,PP5_Very_Strong",
"acmg_by_gene": [
{
"score": 16,
"benign_score": 0,
"pathogenic_score": 16,
"criteria": [
"PVS1",
"PP5_Very_Strong"
],
"verdict": "Pathogenic",
"transcript": "ENST00000298229.7",
"gene_symbol": "INPPL1",
"hgnc_id": 6080,
"effects": [
"frameshift_variant"
],
"inheritance_mode": "AR",
"hgvs_c": "c.94_121delGAGGAGCTGCTGGCCCGGGCGGGCCGCG",
"hgvs_p": "p.Glu32fs"
}
],
"clinvar_disease": "Opsismodysplasia,not provided",
"clinvar_classification": "Pathogenic",
"clinvar_review_status": "criteria provided, multiple submitters, no conflicts",
"clinvar_submissions_summary": "P:2",
"phenotype_combined": "Opsismodysplasia|not provided",
"pathogenicity_classification_combined": "Pathogenic",
"custom_annotations": null
}
],
"message": null
}