← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 11-77184725-GGGAGGCGGGGACACCAGGGCCT-G (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=11&pos=77184725&ref=GGGAGGCGGGGACACCAGGGCCT&alt=G&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "11",
"pos": 77184725,
"ref": "GGGAGGCGGGGACACCAGGGCCT",
"alt": "G",
"effect": "intron_variant",
"transcript": "ENST00000409709.9",
"consequences": [
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 49,
"intron_rank": 27,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "NM_000260.4",
"protein_id": "NP_000251.3",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2215,
"cds_start": -4,
"cds_end": null,
"cds_length": 6648,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7483,
"mane_select": "ENST00000409709.9",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 49,
"intron_rank": 27,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "ENST00000409709.9",
"protein_id": "ENSP00000386331.3",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 2215,
"cds_start": -4,
"cds_end": null,
"cds_length": 6648,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7483,
"mane_select": "NM_000260.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 49,
"intron_rank": 27,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "ENST00000458637.6",
"protein_id": "ENSP00000392185.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 2175,
"cds_start": -4,
"cds_end": null,
"cds_length": 6528,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7336,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 50,
"intron_rank": 28,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3470+12_3470+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "ENST00000409619.6",
"protein_id": "ENSP00000386635.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 2166,
"cds_start": -4,
"cds_end": null,
"cds_length": 6501,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7106,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.1046+12_1046+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "ENST00000458169.2",
"protein_id": "ENSP00000417017.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 1357,
"cds_start": -4,
"cds_end": null,
"cds_length": 4074,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4616,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 32,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "n.1343+12_1343+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "ENST00000670577.1",
"protein_id": "ENSP00000499323.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4966,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GGGDTRA*",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant",
"stop_lost"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.1580_1601delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": "p.Gly527fs",
"transcript": "ENST00000409893.6",
"protein_id": "ENSP00000386689.2",
"transcript_support_level": 5,
"aa_start": 527,
"aa_end": null,
"aa_length": 533,
"cds_start": 1580,
"cds_end": null,
"cds_length": 1602,
"cdna_start": 1580,
"cdna_end": null,
"cdna_length": 1849,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 49,
"intron_rank": 27,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "NM_001127180.2",
"protein_id": "NP_001120652.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2175,
"cds_start": -4,
"cds_end": null,
"cds_length": 6528,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7363,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 50,
"intron_rank": 28,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3470+12_3470+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "NM_001369365.1",
"protein_id": "NP_001356294.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2166,
"cds_start": -4,
"cds_end": null,
"cds_length": 6501,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7449,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "n.30+12_30+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "ENST00000467137.1",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 768,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "n.1046+12_1046+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "ENST00000481328.7",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5740,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 45,
"intron_rank": 26,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "XM_011545046.3",
"protein_id": "XP_011543348.2",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2258,
"cds_start": -4,
"cds_end": null,
"cds_length": 6777,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7190,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 46,
"intron_rank": 26,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "XM_017017778.2",
"protein_id": "XP_016873267.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2256,
"cds_start": -4,
"cds_end": null,
"cds_length": 6771,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7184,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 46,
"intron_rank": 26,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "XM_017017779.2",
"protein_id": "XP_016873268.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2255,
"cds_start": -4,
"cds_end": null,
"cds_length": 6768,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7181,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 48,
"intron_rank": 26,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "XM_017017780.2",
"protein_id": "XP_016873269.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2245,
"cds_start": -4,
"cds_end": null,
"cds_length": 6738,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7380,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 46,
"intron_rank": 27,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "XM_011545044.3",
"protein_id": "XP_011543346.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2228,
"cds_start": -4,
"cds_end": null,
"cds_length": 6687,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7293,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 45,
"intron_rank": 25,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "XM_017017781.2",
"protein_id": "XP_016873270.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2226,
"cds_start": -4,
"cds_end": null,
"cds_length": 6681,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7094,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 45,
"intron_rank": 26,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "XM_017017782.2",
"protein_id": "XP_016873271.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2220,
"cds_start": -4,
"cds_end": null,
"cds_length": 6663,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7075,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 45,
"intron_rank": 26,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "XM_017017783.2",
"protein_id": "XP_016873272.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2219,
"cds_start": -4,
"cds_end": null,
"cds_length": 6660,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7072,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 45,
"intron_rank": 26,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3470+12_3470+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "XM_047426973.1",
"protein_id": "XP_047282929.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2217,
"cds_start": -4,
"cds_end": null,
"cds_length": 6654,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7077,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 48,
"intron_rank": 26,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "XM_017017788.2",
"protein_id": "XP_016873277.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2207,
"cds_start": -4,
"cds_end": null,
"cds_length": 6624,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7266,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 48,
"intron_rank": 26,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "XM_017017784.2",
"protein_id": "XP_016873273.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2206,
"cds_start": -4,
"cds_end": null,
"cds_length": 6621,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7263,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 46,
"intron_rank": 26,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3413+12_3413+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "XM_047426970.1",
"protein_id": "XP_047282926.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2196,
"cds_start": -4,
"cds_end": null,
"cds_length": 6591,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7197,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 44,
"intron_rank": 24,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3362+12_3362+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "XM_017017785.2",
"protein_id": "XP_016873274.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2179,
"cds_start": -4,
"cds_end": null,
"cds_length": 6540,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6953,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 47,
"intron_rank": 26,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "XM_017017786.2",
"protein_id": "XP_016873275.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2154,
"cds_start": -4,
"cds_end": null,
"cds_length": 6465,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6673,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 45,
"intron_rank": 25,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3272+12_3272+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "XM_047426971.1",
"protein_id": "XP_047282927.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2149,
"cds_start": -4,
"cds_end": null,
"cds_length": 6450,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7056,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 44,
"intron_rank": 24,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3245+12_3245+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "XM_011545050.3",
"protein_id": "XP_011543352.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2140,
"cds_start": -4,
"cds_end": null,
"cds_length": 6423,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6919,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 44,
"intron_rank": 26,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "XM_047426972.1",
"protein_id": "XP_047282928.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2095,
"cds_start": -4,
"cds_end": null,
"cds_length": 6288,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6398,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": 26,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "XM_047426974.1",
"protein_id": "XP_047282930.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1879,
"cds_start": -4,
"cds_end": null,
"cds_length": 5640,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5826,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 32,
"intron_rank": 26,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "XM_017017787.2",
"protein_id": "XP_016873276.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1451,
"cds_start": -4,
"cds_end": null,
"cds_length": 4356,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4527,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": 26,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "n.3690+12_3690+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "XR_001747888.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5724,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 33,
"intron_rank": 26,
"intron_rank_end": null,
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"hgvs_c": "n.3690+12_3690+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null,
"transcript": "XR_001747889.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4716,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "MYO7A",
"gene_hgnc_id": 7606,
"dbsnp": "rs111033223",
"frequency_reference_population": 0.45556659,
"hom_count_reference_population": 170662,
"allele_count_reference_population": 718936,
"gnomad_exomes_af": 0.455659,
"gnomad_genomes_af": 0.454697,
"gnomad_exomes_ac": 649803,
"gnomad_genomes_ac": 69133,
"gnomad_exomes_homalt": 154611,
"gnomad_genomes_homalt": 16051,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 1.092,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": -8,
"acmg_classification": "Benign",
"acmg_criteria": "BA1",
"acmg_by_gene": [
{
"score": -8,
"benign_score": 8,
"pathogenic_score": 0,
"criteria": [
"BA1"
],
"verdict": "Benign",
"transcript": "ENST00000409709.9",
"gene_symbol": "MYO7A",
"hgnc_id": 7606,
"effects": [
"intron_variant"
],
"inheritance_mode": "AD,AR",
"hgvs_c": "c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG",
"hgvs_p": null
}
],
"clinvar_disease": "Autosomal dominant nonsyndromic hearing loss 11,Autosomal recessive nonsyndromic hearing loss 2,Nonsyndromic genetic hearing loss,Usher syndrome type 1,Usher syndrome type 1B,not provided,not specified",
"clinvar_classification": "Benign",
"clinvar_review_status": "reviewed by expert panel",
"clinvar_submissions_summary": "B:9",
"phenotype_combined": "not specified|Nonsyndromic genetic hearing loss|Autosomal recessive nonsyndromic hearing loss 2|not provided|Usher syndrome type 1B|Autosomal dominant nonsyndromic hearing loss 11;Autosomal recessive nonsyndromic hearing loss 2;Usher syndrome type 1",
"pathogenicity_classification_combined": "Benign",
"custom_annotations": null
}
],
"message": null
}