← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 11-77184725-GGGAGGCGGGGACACCAGGGCCT-G (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=11&pos=77184725&ref=GGGAGGCGGGGACACCAGGGCCT&alt=G&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "11",
      "pos": 77184725,
      "ref": "GGGAGGCGGGGACACCAGGGCCT",
      "alt": "G",
      "effect": "intron_variant",
      "transcript": "ENST00000409709.9",
      "consequences": [
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 49,
          "intron_rank": 27,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "NM_000260.4",
          "protein_id": "NP_000251.3",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2215,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6648,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 7483,
          "mane_select": "ENST00000409709.9",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 49,
          "intron_rank": 27,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "ENST00000409709.9",
          "protein_id": "ENSP00000386331.3",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2215,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6648,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 7483,
          "mane_select": "NM_000260.4",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 49,
          "intron_rank": 27,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "ENST00000458637.6",
          "protein_id": "ENSP00000392185.2",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2175,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6528,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 7336,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 50,
          "intron_rank": 28,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3470+12_3470+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "ENST00000409619.6",
          "protein_id": "ENSP00000386635.2",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2166,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6501,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 7106,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 29,
          "intron_rank": 7,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.1046+12_1046+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "ENST00000458169.2",
          "protein_id": "ENSP00000417017.2",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 1357,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 4074,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4616,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": true,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 32,
          "intron_rank": 10,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "n.1343+12_1343+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "ENST00000670577.1",
          "protein_id": "ENSP00000499323.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4966,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "GGGDTRA*",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant",
            "stop_lost"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 11,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.1580_1601delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": "p.Gly527fs",
          "transcript": "ENST00000409893.6",
          "protein_id": "ENSP00000386689.2",
          "transcript_support_level": 5,
          "aa_start": 527,
          "aa_end": null,
          "aa_length": 533,
          "cds_start": 1580,
          "cds_end": null,
          "cds_length": 1602,
          "cdna_start": 1580,
          "cdna_end": null,
          "cdna_length": 1849,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 49,
          "intron_rank": 27,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "NM_001127180.2",
          "protein_id": "NP_001120652.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2175,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6528,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 7363,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 50,
          "intron_rank": 28,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3470+12_3470+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "NM_001369365.1",
          "protein_id": "NP_001356294.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2166,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6501,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 7449,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "n.30+12_30+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "ENST00000467137.1",
          "protein_id": null,
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 768,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 29,
          "intron_rank": 7,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "n.1046+12_1046+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "ENST00000481328.7",
          "protein_id": null,
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 5740,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 45,
          "intron_rank": 26,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "XM_011545046.3",
          "protein_id": "XP_011543348.2",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2258,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6777,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 7190,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 46,
          "intron_rank": 26,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "XM_017017778.2",
          "protein_id": "XP_016873267.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2256,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6771,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 7184,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 46,
          "intron_rank": 26,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "XM_017017779.2",
          "protein_id": "XP_016873268.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2255,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6768,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 7181,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 48,
          "intron_rank": 26,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "XM_017017780.2",
          "protein_id": "XP_016873269.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2245,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6738,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 7380,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 46,
          "intron_rank": 27,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "XM_011545044.3",
          "protein_id": "XP_011543346.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2228,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6687,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 7293,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 45,
          "intron_rank": 25,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "XM_017017781.2",
          "protein_id": "XP_016873270.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2226,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6681,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 7094,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 45,
          "intron_rank": 26,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "XM_017017782.2",
          "protein_id": "XP_016873271.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2220,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6663,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 7075,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 45,
          "intron_rank": 26,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "XM_017017783.2",
          "protein_id": "XP_016873272.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2219,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6660,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 7072,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 45,
          "intron_rank": 26,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3470+12_3470+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "XM_047426973.1",
          "protein_id": "XP_047282929.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2217,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6654,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 7077,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 48,
          "intron_rank": 26,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "XM_017017788.2",
          "protein_id": "XP_016873277.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2207,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6624,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 7266,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 48,
          "intron_rank": 26,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "XM_017017784.2",
          "protein_id": "XP_016873273.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2206,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6621,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 7263,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 46,
          "intron_rank": 26,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3413+12_3413+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "XM_047426970.1",
          "protein_id": "XP_047282926.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2196,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6591,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 7197,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 44,
          "intron_rank": 24,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3362+12_3362+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "XM_017017785.2",
          "protein_id": "XP_016873274.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2179,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6540,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6953,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 47,
          "intron_rank": 26,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "XM_017017786.2",
          "protein_id": "XP_016873275.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2154,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6465,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6673,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 45,
          "intron_rank": 25,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3272+12_3272+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "XM_047426971.1",
          "protein_id": "XP_047282927.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2149,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6450,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 7056,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 44,
          "intron_rank": 24,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3245+12_3245+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "XM_011545050.3",
          "protein_id": "XP_011543352.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2140,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6423,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6919,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 44,
          "intron_rank": 26,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "XM_047426972.1",
          "protein_id": "XP_047282928.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 2095,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 6288,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6398,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": 26,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "XM_047426974.1",
          "protein_id": "XP_047282930.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 1879,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 5640,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 5826,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 32,
          "intron_rank": 26,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "c.3593+12_3593+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "XM_017017787.2",
          "protein_id": "XP_016873276.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 1451,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 4356,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4527,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 39,
          "intron_rank": 26,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "n.3690+12_3690+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "XR_001747888.2",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 5724,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 33,
          "intron_rank": 26,
          "intron_rank_end": null,
          "gene_symbol": "MYO7A",
          "gene_hgnc_id": 7606,
          "hgvs_c": "n.3690+12_3690+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null,
          "transcript": "XR_001747889.2",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4716,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "MYO7A",
      "gene_hgnc_id": 7606,
      "dbsnp": "rs111033223",
      "frequency_reference_population": 0.45556659,
      "hom_count_reference_population": 170662,
      "allele_count_reference_population": 718936,
      "gnomad_exomes_af": 0.455659,
      "gnomad_genomes_af": 0.454697,
      "gnomad_exomes_ac": 649803,
      "gnomad_genomes_ac": 69133,
      "gnomad_exomes_homalt": 154611,
      "gnomad_genomes_homalt": 16051,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 1.092,
      "phylop100way_prediction": "Benign",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": -8,
      "acmg_classification": "Benign",
      "acmg_criteria": "BA1",
      "acmg_by_gene": [
        {
          "score": -8,
          "benign_score": 8,
          "pathogenic_score": 0,
          "criteria": [
            "BA1"
          ],
          "verdict": "Benign",
          "transcript": "ENST00000409709.9",
          "gene_symbol": "MYO7A",
          "hgnc_id": 7606,
          "effects": [
            "intron_variant"
          ],
          "inheritance_mode": "AD,AR",
          "hgvs_c": "c.3503+12_3503+33delGAGGCGGGGACACCAGGGCCTG",
          "hgvs_p": null
        }
      ],
      "clinvar_disease": "Autosomal dominant nonsyndromic hearing loss 11,Autosomal recessive nonsyndromic hearing loss 2,Nonsyndromic genetic hearing loss,Usher syndrome type 1,Usher syndrome type 1B,not provided,not specified",
      "clinvar_classification": "Benign",
      "clinvar_review_status": "reviewed by expert panel",
      "clinvar_submissions_summary": "B:9",
      "phenotype_combined": "not specified|Nonsyndromic genetic hearing loss|Autosomal recessive nonsyndromic hearing loss 2|not provided|Usher syndrome type 1B|Autosomal dominant nonsyndromic hearing loss 11;Autosomal recessive nonsyndromic hearing loss 2;Usher syndrome type 1",
      "pathogenicity_classification_combined": "Benign",
      "custom_annotations": null
    }
  ],
  "message": null
}