← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 12-32792602-TGGCTCTGTTAACTATGACACATTCCTTGTTCATGTTCTTACCTTCTTGTA-T (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=12&pos=32792602&ref=TGGCTCTGTTAACTATGACACATTCCTTGTTCATGTTCTTACCTTCTTGTA&alt=T&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "12",
"pos": 32792602,
"ref": "TGGCTCTGTTAACTATGACACATTCCTTGTTCATGTTCTTACCTTCTTGTA",
"alt": "T",
"effect": "splice_donor_variant,conservative_inframe_deletion,splice_region_variant,intron_variant",
"transcript": "ENST00000340811.9",
"consequences": [
{
"aa_ref": "YKK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_donor_variant",
"conservative_inframe_deletion",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKP2",
"gene_hgnc_id": 9024,
"hgvs_c": "c.2437_2445+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
"hgvs_p": "p.Tyr813_Lys815del",
"transcript": "NM_001005242.3",
"protein_id": "NP_001005242.2",
"transcript_support_level": null,
"aa_start": 813,
"aa_end": null,
"aa_length": 837,
"cds_start": 2437,
"cds_end": null,
"cds_length": 2514,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4229,
"mane_select": "ENST00000340811.9",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YKK",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_donor_variant",
"conservative_inframe_deletion",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKP2",
"gene_hgnc_id": 9024,
"hgvs_c": "c.2437_2445+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
"hgvs_p": "p.Tyr813_Lys815del",
"transcript": "ENST00000340811.9",
"protein_id": "ENSP00000342800.5",
"transcript_support_level": 1,
"aa_start": 813,
"aa_end": null,
"aa_length": 837,
"cds_start": 2437,
"cds_end": null,
"cds_length": 2514,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4229,
"mane_select": "NM_001005242.3",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YKK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_donor_variant",
"conservative_inframe_deletion",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 13,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKP2",
"gene_hgnc_id": 9024,
"hgvs_c": "c.2569_2577+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
"hgvs_p": "p.Tyr857_Lys859del",
"transcript": "ENST00000070846.11",
"protein_id": "ENSP00000070846.6",
"transcript_support_level": 1,
"aa_start": 857,
"aa_end": null,
"aa_length": 881,
"cds_start": 2569,
"cds_end": null,
"cds_length": 2646,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4361,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKP2",
"gene_hgnc_id": 9024,
"hgvs_c": "n.1652_1701delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
"hgvs_p": null,
"transcript": "ENST00000700560.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2433,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YKK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_donor_variant",
"conservative_inframe_deletion",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 13,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKP2",
"gene_hgnc_id": 9024,
"hgvs_c": "c.2569_2577+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
"hgvs_p": "p.Tyr857_Lys859del",
"transcript": "NM_004572.4",
"protein_id": "NP_004563.2",
"transcript_support_level": null,
"aa_start": 857,
"aa_end": null,
"aa_length": 881,
"cds_start": 2569,
"cds_end": null,
"cds_length": 2646,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4361,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PTRR",
"aa_alt": "P",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_donor_variant",
"disruptive_inframe_deletion",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKP2",
"gene_hgnc_id": 9024,
"hgvs_c": "c.2247_2255+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
"hgvs_p": "p.Thr750_Arg752del",
"transcript": "NM_001407155.1",
"protein_id": "NP_001394084.1",
"transcript_support_level": null,
"aa_start": 749,
"aa_end": null,
"aa_length": 822,
"cds_start": 2247,
"cds_end": null,
"cds_length": 2469,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4039,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PTRR",
"aa_alt": "P",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_donor_variant",
"disruptive_inframe_deletion",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKP2",
"gene_hgnc_id": 9024,
"hgvs_c": "c.2247_2255+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
"hgvs_p": "p.Thr750_Arg752del",
"transcript": "ENST00000700559.2",
"protein_id": "ENSP00000515065.2",
"transcript_support_level": null,
"aa_start": 749,
"aa_end": null,
"aa_length": 822,
"cds_start": 2247,
"cds_end": null,
"cds_length": 2469,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4070,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YKK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_donor_variant",
"conservative_inframe_deletion",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKP2",
"gene_hgnc_id": 9024,
"hgvs_c": "c.2272_2280+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
"hgvs_p": "p.Tyr758_Lys760del",
"transcript": "NM_001407156.1",
"protein_id": "NP_001394085.1",
"transcript_support_level": null,
"aa_start": 758,
"aa_end": null,
"aa_length": 782,
"cds_start": 2272,
"cds_end": null,
"cds_length": 2349,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4064,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YKK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_donor_variant",
"conservative_inframe_deletion",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 13,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKP2",
"gene_hgnc_id": 9024,
"hgvs_c": "c.2110_2118+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
"hgvs_p": "p.Tyr704_Lys706del",
"transcript": "NM_001407158.1",
"protein_id": "NP_001394087.1",
"transcript_support_level": null,
"aa_start": 704,
"aa_end": null,
"aa_length": 728,
"cds_start": 2110,
"cds_end": null,
"cds_length": 2187,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4728,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YKK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_donor_variant",
"conservative_inframe_deletion",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 13,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKP2",
"gene_hgnc_id": 9024,
"hgvs_c": "c.2110_2118+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
"hgvs_p": "p.Tyr704_Lys706del",
"transcript": "NM_001407159.1",
"protein_id": "NP_001394088.1",
"transcript_support_level": null,
"aa_start": 704,
"aa_end": null,
"aa_length": 728,
"cds_start": 2110,
"cds_end": null,
"cds_length": 2187,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4492,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PTRR",
"aa_alt": "P",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_donor_variant",
"disruptive_inframe_deletion",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKP2",
"gene_hgnc_id": 9024,
"hgvs_c": "c.1920_1928+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
"hgvs_p": "p.Thr641_Arg643del",
"transcript": "NM_001407160.1",
"protein_id": "NP_001394089.1",
"transcript_support_level": null,
"aa_start": 640,
"aa_end": null,
"aa_length": 713,
"cds_start": 1920,
"cds_end": null,
"cds_length": 2142,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4302,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YKK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_donor_variant",
"conservative_inframe_deletion",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKP2",
"gene_hgnc_id": 9024,
"hgvs_c": "c.580_588+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
"hgvs_p": "p.Tyr194_Lys196del",
"transcript": "ENST00000549461.3",
"protein_id": "ENSP00000519092.1",
"transcript_support_level": 2,
"aa_start": 194,
"aa_end": null,
"aa_length": 218,
"cds_start": 580,
"cds_end": null,
"cds_length": 657,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2732,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YKK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_donor_variant",
"conservative_inframe_deletion",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKP2",
"gene_hgnc_id": 9024,
"hgvs_c": "c.580_588+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
"hgvs_p": "p.Tyr194_Lys196del",
"transcript": "ENST00000700558.2",
"protein_id": "ENSP00000519093.1",
"transcript_support_level": null,
"aa_start": 194,
"aa_end": null,
"aa_length": 218,
"cds_start": 580,
"cds_end": null,
"cds_length": 657,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1463,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"splice_donor_variant",
"splice_region_variant",
"intron_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKP2",
"gene_hgnc_id": 9024,
"hgvs_c": "n.1124_1132+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
"hgvs_p": null,
"transcript": "ENST00000546498.2",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1519,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"splice_donor_variant",
"splice_region_variant",
"intron_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKP2",
"gene_hgnc_id": 9024,
"hgvs_c": "n.224_232+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
"hgvs_p": null,
"transcript": "ENST00000546769.1",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 782,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"splice_donor_variant",
"splice_region_variant",
"intron_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKP2",
"gene_hgnc_id": 9024,
"hgvs_c": "n.940_948+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
"hgvs_p": null,
"transcript": "ENST00000700555.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2696,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"splice_donor_variant",
"splice_region_variant",
"intron_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKP2",
"gene_hgnc_id": 9024,
"hgvs_c": "n.529_537+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
"hgvs_p": null,
"transcript": "ENST00000700557.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2018,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "PKP2",
"gene_hgnc_id": 9024,
"dbsnp": "rs1064792928",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": 7.01627e-7,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": 1,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": 0,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 1.38,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 10,
"acmg_classification": "Pathogenic",
"acmg_criteria": "PVS1_Moderate,PP5_Very_Strong",
"acmg_by_gene": [
{
"score": 10,
"benign_score": 0,
"pathogenic_score": 10,
"criteria": [
"PVS1_Moderate",
"PP5_Very_Strong"
],
"verdict": "Pathogenic",
"transcript": "ENST00000340811.9",
"gene_symbol": "PKP2",
"hgnc_id": 9024,
"effects": [
"splice_donor_variant",
"conservative_inframe_deletion",
"splice_region_variant",
"intron_variant"
],
"inheritance_mode": "AD",
"hgvs_c": "c.2437_2445+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
"hgvs_p": "p.Tyr813_Lys815del"
}
],
"clinvar_disease": "Arrhythmogenic right ventricular dysplasia 9,Cardiomyopathy,Cardiovascular phenotype,Familial isolated arrhythmogenic right ventricular dysplasia,not provided",
"clinvar_classification": "Pathogenic/Likely pathogenic",
"clinvar_review_status": "criteria provided, multiple submitters, no conflicts",
"clinvar_submissions_summary": "P:2 LP:3",
"phenotype_combined": "Arrhythmogenic right ventricular dysplasia 9|Cardiomyopathy|Familial isolated arrhythmogenic right ventricular dysplasia|not provided|Cardiovascular phenotype",
"pathogenicity_classification_combined": "Pathogenic/Likely pathogenic",
"custom_annotations": null
}
],
"message": null
}