← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 12-32792602-TGGCTCTGTTAACTATGACACATTCCTTGTTCATGTTCTTACCTTCTTGTA-T (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=12&pos=32792602&ref=TGGCTCTGTTAACTATGACACATTCCTTGTTCATGTTCTTACCTTCTTGTA&alt=T&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "12",
      "pos": 32792602,
      "ref": "TGGCTCTGTTAACTATGACACATTCCTTGTTCATGTTCTTACCTTCTTGTA",
      "alt": "T",
      "effect": "splice_donor_variant,conservative_inframe_deletion,splice_region_variant,intron_variant",
      "transcript": "ENST00000340811.9",
      "consequences": [
        {
          "aa_ref": "YKK",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_donor_variant",
            "conservative_inframe_deletion",
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "PKP2",
          "gene_hgnc_id": 9024,
          "hgvs_c": "c.2437_2445+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
          "hgvs_p": "p.Tyr813_Lys815del",
          "transcript": "NM_001005242.3",
          "protein_id": "NP_001005242.2",
          "transcript_support_level": null,
          "aa_start": 813,
          "aa_end": null,
          "aa_length": 837,
          "cds_start": 2437,
          "cds_end": null,
          "cds_length": 2514,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4229,
          "mane_select": "ENST00000340811.9",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YKK",
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_donor_variant",
            "conservative_inframe_deletion",
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "PKP2",
          "gene_hgnc_id": 9024,
          "hgvs_c": "c.2437_2445+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
          "hgvs_p": "p.Tyr813_Lys815del",
          "transcript": "ENST00000340811.9",
          "protein_id": "ENSP00000342800.5",
          "transcript_support_level": 1,
          "aa_start": 813,
          "aa_end": null,
          "aa_length": 837,
          "cds_start": 2437,
          "cds_end": null,
          "cds_length": 2514,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4229,
          "mane_select": "NM_001005242.3",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YKK",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_donor_variant",
            "conservative_inframe_deletion",
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": 13,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "PKP2",
          "gene_hgnc_id": 9024,
          "hgvs_c": "c.2569_2577+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
          "hgvs_p": "p.Tyr857_Lys859del",
          "transcript": "ENST00000070846.11",
          "protein_id": "ENSP00000070846.6",
          "transcript_support_level": 1,
          "aa_start": 857,
          "aa_end": null,
          "aa_length": 881,
          "cds_start": 2569,
          "cds_end": null,
          "cds_length": 2646,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4361,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 10,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "PKP2",
          "gene_hgnc_id": 9024,
          "hgvs_c": "n.1652_1701delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
          "hgvs_p": null,
          "transcript": "ENST00000700560.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2433,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YKK",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_donor_variant",
            "conservative_inframe_deletion",
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": 13,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "PKP2",
          "gene_hgnc_id": 9024,
          "hgvs_c": "c.2569_2577+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
          "hgvs_p": "p.Tyr857_Lys859del",
          "transcript": "NM_004572.4",
          "protein_id": "NP_004563.2",
          "transcript_support_level": null,
          "aa_start": 857,
          "aa_end": null,
          "aa_length": 881,
          "cds_start": 2569,
          "cds_end": null,
          "cds_length": 2646,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4361,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PTRR",
          "aa_alt": "P",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_donor_variant",
            "disruptive_inframe_deletion",
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 12,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "PKP2",
          "gene_hgnc_id": 9024,
          "hgvs_c": "c.2247_2255+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
          "hgvs_p": "p.Thr750_Arg752del",
          "transcript": "NM_001407155.1",
          "protein_id": "NP_001394084.1",
          "transcript_support_level": null,
          "aa_start": 749,
          "aa_end": null,
          "aa_length": 822,
          "cds_start": 2247,
          "cds_end": null,
          "cds_length": 2469,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4039,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PTRR",
          "aa_alt": "P",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_donor_variant",
            "disruptive_inframe_deletion",
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 12,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "PKP2",
          "gene_hgnc_id": 9024,
          "hgvs_c": "c.2247_2255+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
          "hgvs_p": "p.Thr750_Arg752del",
          "transcript": "ENST00000700559.2",
          "protein_id": "ENSP00000515065.2",
          "transcript_support_level": null,
          "aa_start": 749,
          "aa_end": null,
          "aa_length": 822,
          "cds_start": 2247,
          "cds_end": null,
          "cds_length": 2469,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4070,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YKK",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_donor_variant",
            "conservative_inframe_deletion",
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 12,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "PKP2",
          "gene_hgnc_id": 9024,
          "hgvs_c": "c.2272_2280+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
          "hgvs_p": "p.Tyr758_Lys760del",
          "transcript": "NM_001407156.1",
          "protein_id": "NP_001394085.1",
          "transcript_support_level": null,
          "aa_start": 758,
          "aa_end": null,
          "aa_length": 782,
          "cds_start": 2272,
          "cds_end": null,
          "cds_length": 2349,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4064,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YKK",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_donor_variant",
            "conservative_inframe_deletion",
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": 13,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "PKP2",
          "gene_hgnc_id": 9024,
          "hgvs_c": "c.2110_2118+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
          "hgvs_p": "p.Tyr704_Lys706del",
          "transcript": "NM_001407158.1",
          "protein_id": "NP_001394087.1",
          "transcript_support_level": null,
          "aa_start": 704,
          "aa_end": null,
          "aa_length": 728,
          "cds_start": 2110,
          "cds_end": null,
          "cds_length": 2187,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4728,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YKK",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_donor_variant",
            "conservative_inframe_deletion",
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": 13,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "PKP2",
          "gene_hgnc_id": 9024,
          "hgvs_c": "c.2110_2118+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
          "hgvs_p": "p.Tyr704_Lys706del",
          "transcript": "NM_001407159.1",
          "protein_id": "NP_001394088.1",
          "transcript_support_level": null,
          "aa_start": 704,
          "aa_end": null,
          "aa_length": 728,
          "cds_start": 2110,
          "cds_end": null,
          "cds_length": 2187,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4492,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PTRR",
          "aa_alt": "P",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_donor_variant",
            "disruptive_inframe_deletion",
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "PKP2",
          "gene_hgnc_id": 9024,
          "hgvs_c": "c.1920_1928+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
          "hgvs_p": "p.Thr641_Arg643del",
          "transcript": "NM_001407160.1",
          "protein_id": "NP_001394089.1",
          "transcript_support_level": null,
          "aa_start": 640,
          "aa_end": null,
          "aa_length": 713,
          "cds_start": 1920,
          "cds_end": null,
          "cds_length": 2142,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4302,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YKK",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_donor_variant",
            "conservative_inframe_deletion",
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "PKP2",
          "gene_hgnc_id": 9024,
          "hgvs_c": "c.580_588+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
          "hgvs_p": "p.Tyr194_Lys196del",
          "transcript": "ENST00000549461.3",
          "protein_id": "ENSP00000519092.1",
          "transcript_support_level": 2,
          "aa_start": 194,
          "aa_end": null,
          "aa_length": 218,
          "cds_start": 580,
          "cds_end": null,
          "cds_length": 657,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2732,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YKK",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_donor_variant",
            "conservative_inframe_deletion",
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "PKP2",
          "gene_hgnc_id": 9024,
          "hgvs_c": "c.580_588+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
          "hgvs_p": "p.Tyr194_Lys196del",
          "transcript": "ENST00000700558.2",
          "protein_id": "ENSP00000519093.1",
          "transcript_support_level": null,
          "aa_start": 194,
          "aa_end": null,
          "aa_length": 218,
          "cds_start": 580,
          "cds_end": null,
          "cds_length": 657,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1463,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "splice_donor_variant",
            "splice_region_variant",
            "intron_variant",
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "PKP2",
          "gene_hgnc_id": 9024,
          "hgvs_c": "n.1124_1132+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
          "hgvs_p": null,
          "transcript": "ENST00000546498.2",
          "protein_id": null,
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1519,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "splice_donor_variant",
            "splice_region_variant",
            "intron_variant",
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 2,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "PKP2",
          "gene_hgnc_id": 9024,
          "hgvs_c": "n.224_232+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
          "hgvs_p": null,
          "transcript": "ENST00000546769.1",
          "protein_id": null,
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 782,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "splice_donor_variant",
            "splice_region_variant",
            "intron_variant",
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "PKP2",
          "gene_hgnc_id": 9024,
          "hgvs_c": "n.940_948+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
          "hgvs_p": null,
          "transcript": "ENST00000700555.2",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2696,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "splice_donor_variant",
            "splice_region_variant",
            "intron_variant",
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "PKP2",
          "gene_hgnc_id": 9024,
          "hgvs_c": "n.529_537+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
          "hgvs_p": null,
          "transcript": "ENST00000700557.2",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2018,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "PKP2",
      "gene_hgnc_id": 9024,
      "dbsnp": "rs1064792928",
      "frequency_reference_population": null,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 0,
      "gnomad_exomes_af": 7.01627e-7,
      "gnomad_genomes_af": null,
      "gnomad_exomes_ac": 1,
      "gnomad_genomes_ac": null,
      "gnomad_exomes_homalt": 0,
      "gnomad_genomes_homalt": null,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 1.38,
      "phylop100way_prediction": "Benign",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 10,
      "acmg_classification": "Pathogenic",
      "acmg_criteria": "PVS1_Moderate,PP5_Very_Strong",
      "acmg_by_gene": [
        {
          "score": 10,
          "benign_score": 0,
          "pathogenic_score": 10,
          "criteria": [
            "PVS1_Moderate",
            "PP5_Very_Strong"
          ],
          "verdict": "Pathogenic",
          "transcript": "ENST00000340811.9",
          "gene_symbol": "PKP2",
          "hgnc_id": 9024,
          "effects": [
            "splice_donor_variant",
            "conservative_inframe_deletion",
            "splice_region_variant",
            "intron_variant"
          ],
          "inheritance_mode": "AD",
          "hgvs_c": "c.2437_2445+41delTACAAGAAGGTAAGAACATGAACAAGGAATGTGTCATAGTTAACAGAGCC",
          "hgvs_p": "p.Tyr813_Lys815del"
        }
      ],
      "clinvar_disease": "Arrhythmogenic right ventricular dysplasia 9,Cardiomyopathy,Cardiovascular phenotype,Familial isolated arrhythmogenic right ventricular dysplasia,not provided",
      "clinvar_classification": "Pathogenic/Likely pathogenic",
      "clinvar_review_status": "criteria provided, multiple submitters, no conflicts",
      "clinvar_submissions_summary": "P:2 LP:3",
      "phenotype_combined": "Arrhythmogenic right ventricular dysplasia 9|Cardiomyopathy|Familial isolated arrhythmogenic right ventricular dysplasia|not provided|Cardiovascular phenotype",
      "pathogenicity_classification_combined": "Pathogenic/Likely pathogenic",
      "custom_annotations": null
    }
  ],
  "message": null
}