← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 12-49038880-C-CTGCTGTTGCCTGTTGTTGCTGCCACAGTTGT (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=12&pos=49038880&ref=C&alt=CTGCTGTTGCCTGTTGTTGCTGCCACAGTTGT&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "12",
"pos": 49038880,
"ref": "C",
"alt": "CTGCTGTTGCCTGTTGTTGCTGCCACAGTTGT",
"effect": "frameshift_variant",
"transcript": "ENST00000301067.12",
"consequences": [
{
"aa_ref": "A",
"aa_alt": "ATTVAATTGNS?",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 35,
"exon_rank_end": null,
"exon_count": 55,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KMT2D",
"gene_hgnc_id": 7133,
"hgvs_c": "c.8445_8475dupACAACTGTGGCAGCAACAACAGGCAACAGCA",
"hgvs_p": "p.Ala2826fs",
"transcript": "NM_003482.4",
"protein_id": "NP_003473.3",
"transcript_support_level": null,
"aa_start": 2825,
"aa_end": null,
"aa_length": 5537,
"cds_start": 8475,
"cds_end": null,
"cds_length": 16614,
"cdna_start": 9694,
"cdna_end": null,
"cdna_length": 20635,
"mane_select": "ENST00000301067.12",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "A",
"aa_alt": "ATTVAATTGNS?",
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 35,
"exon_rank_end": null,
"exon_count": 55,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KMT2D",
"gene_hgnc_id": 7133,
"hgvs_c": "c.8445_8475dupACAACTGTGGCAGCAACAACAGGCAACAGCA",
"hgvs_p": "p.Ala2826fs",
"transcript": "ENST00000301067.12",
"protein_id": "ENSP00000301067.7",
"transcript_support_level": 5,
"aa_start": 2825,
"aa_end": null,
"aa_length": 5537,
"cds_start": 8475,
"cds_end": null,
"cds_length": 16614,
"cdna_start": 9694,
"cdna_end": null,
"cdna_length": 20635,
"mane_select": "NM_003482.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "A",
"aa_alt": "ATTVAATTGNS?",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 35,
"exon_rank_end": null,
"exon_count": 56,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KMT2D",
"gene_hgnc_id": 7133,
"hgvs_c": "c.8445_8475dupACAACTGTGGCAGCAACAACAGGCAACAGCA",
"hgvs_p": "p.Ala2826fs",
"transcript": "ENST00000683543.2",
"protein_id": "ENSP00000506726.1",
"transcript_support_level": null,
"aa_start": 2825,
"aa_end": null,
"aa_length": 5553,
"cds_start": 8475,
"cds_end": null,
"cds_length": 16662,
"cdna_start": 9694,
"cdna_end": null,
"cdna_length": 20686,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "A",
"aa_alt": "ATTVAATTGNS?",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 34,
"exon_rank_end": null,
"exon_count": 54,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KMT2D",
"gene_hgnc_id": 7133,
"hgvs_c": "c.8454_8484dupACAACTGTGGCAGCAACAACAGGCAACAGCA",
"hgvs_p": "p.Ala2829fs",
"transcript": "ENST00000685166.1",
"protein_id": "ENSP00000509386.1",
"transcript_support_level": null,
"aa_start": 2828,
"aa_end": null,
"aa_length": 5540,
"cds_start": 8484,
"cds_end": null,
"cds_length": 16623,
"cdna_start": 8484,
"cdna_end": null,
"cdna_length": 16623,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "A",
"aa_alt": "ATTVAATTGNS?",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 34,
"exon_rank_end": null,
"exon_count": 54,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KMT2D",
"gene_hgnc_id": 7133,
"hgvs_c": "c.8442_8472dupACAACTGTGGCAGCAACAACAGGCAACAGCA",
"hgvs_p": "p.Ala2825fs",
"transcript": "ENST00000692637.1",
"protein_id": "ENSP00000509666.1",
"transcript_support_level": null,
"aa_start": 2824,
"aa_end": null,
"aa_length": 5536,
"cds_start": 8472,
"cds_end": null,
"cds_length": 16611,
"cdna_start": 8472,
"cdna_end": null,
"cdna_length": 16611,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "A",
"aa_alt": "ATTVAATTGNS?",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KMT2D",
"gene_hgnc_id": 7133,
"hgvs_c": "c.9_39dupACAACTGTGGCAGCAACAACAGGCAACAGCA",
"hgvs_p": "p.Ala14fs",
"transcript": "ENST00000687201.1",
"protein_id": "ENSP00000510037.1",
"transcript_support_level": null,
"aa_start": 13,
"aa_end": null,
"aa_length": 1256,
"cds_start": 39,
"cds_end": null,
"cds_length": 3771,
"cdna_start": 39,
"cdna_end": null,
"cdna_length": 3771,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KMT2D",
"gene_hgnc_id": 7133,
"hgvs_c": "n.144_174dupACAACTGTGGCAGCAACAACAGGCAACAGCA",
"hgvs_p": null,
"transcript": "ENST00000683043.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2444,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KMT2D",
"gene_hgnc_id": 7133,
"hgvs_c": "n.2048_2078dupACAACTGTGGCAGCAACAACAGGCAACAGCA",
"hgvs_p": null,
"transcript": "ENST00000689143.1",
"protein_id": "ENSP00000509839.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3958,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "KMT2D",
"gene_hgnc_id": 7133,
"hgvs_c": "n.9_39dupACAACTGTGGCAGCAACAACAGGCAACAGCA",
"hgvs_p": null,
"transcript": "ENST00000692841.1",
"protein_id": "ENSP00000508711.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5009,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "KMT2D",
"gene_hgnc_id": 7133,
"dbsnp": "rs797045671",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 0.351,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 10,
"acmg_classification": "Pathogenic",
"acmg_criteria": "PVS1,PP5_Moderate",
"acmg_by_gene": [
{
"score": 10,
"benign_score": 0,
"pathogenic_score": 10,
"criteria": [
"PVS1",
"PP5_Moderate"
],
"verdict": "Pathogenic",
"transcript": "ENST00000301067.12",
"gene_symbol": "KMT2D",
"hgnc_id": 7133,
"effects": [
"frameshift_variant"
],
"inheritance_mode": "AD",
"hgvs_c": "c.8445_8475dupACAACTGTGGCAGCAACAACAGGCAACAGCA",
"hgvs_p": "p.Ala2826fs"
}
],
"clinvar_disease": "Kabuki syndrome 1",
"clinvar_classification": "Pathogenic",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "P:1",
"phenotype_combined": "Kabuki syndrome 1",
"pathogenicity_classification_combined": "Pathogenic",
"custom_annotations": null
}
],
"message": null
}