← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 13-32338116-AGGT-TTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=13&pos=32338116&ref=AGGT&alt=TTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "13",
"pos": 32338116,
"ref": "AGGT",
"alt": "TTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"effect": "frameshift_variant,stop_gained",
"transcript": "ENST00000530893.7",
"consequences": [
{
"aa_ref": "EV",
"aa_alt": "VYLQVSLSSSKYLQV?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant",
"stop_gained"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "c.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": "p.Glu1254fs",
"transcript": "NM_000059.4",
"protein_id": "NP_000050.3",
"transcript_support_level": null,
"aa_start": 1254,
"aa_end": null,
"aa_length": 3418,
"cds_start": 3761,
"cds_end": null,
"cds_length": 10257,
"cdna_start": 3960,
"cdna_end": null,
"cdna_length": 11954,
"mane_select": "ENST00000380152.8",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EV",
"aa_alt": "VYLQVSLSSSKYLQV?",
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant",
"stop_gained"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "c.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": "p.Glu1254fs",
"transcript": "ENST00000380152.8",
"protein_id": "ENSP00000369497.3",
"transcript_support_level": 5,
"aa_start": 1254,
"aa_end": null,
"aa_length": 3418,
"cds_start": 3761,
"cds_end": null,
"cds_length": 10257,
"cdna_start": 3960,
"cdna_end": null,
"cdna_length": 11954,
"mane_select": "NM_000059.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EV",
"aa_alt": "VYLQVSLSSSKYLQV?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant",
"stop_gained"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "c.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": "p.Glu1254fs",
"transcript": "ENST00000544455.6",
"protein_id": "ENSP00000439902.1",
"transcript_support_level": 1,
"aa_start": 1254,
"aa_end": null,
"aa_length": 3418,
"cds_start": 3761,
"cds_end": null,
"cds_length": 10257,
"cdna_start": 3860,
"cdna_end": null,
"cdna_length": 11854,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EV",
"aa_alt": "VYLQVSLSSSKYLQV?",
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant",
"stop_gained"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "c.3392_3395delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": "p.Glu1131fs",
"transcript": "ENST00000530893.7",
"protein_id": "ENSP00000499438.2",
"transcript_support_level": 1,
"aa_start": 1131,
"aa_end": null,
"aa_length": 3295,
"cds_start": 3392,
"cds_end": null,
"cds_length": 9888,
"cdna_start": 3959,
"cdna_end": null,
"cdna_length": 11953,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 26,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "n.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": null,
"transcript": "ENST00000614259.2",
"protein_id": "ENSP00000506251.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 11763,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EV",
"aa_alt": "VYLQVSLSSSKYLQV?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant",
"stop_gained"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "c.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": "p.Glu1254fs",
"transcript": "NM_001432077.1",
"protein_id": "NP_001419006.1",
"transcript_support_level": null,
"aa_start": 1254,
"aa_end": null,
"aa_length": 3418,
"cds_start": 3761,
"cds_end": null,
"cds_length": 10257,
"cdna_start": 3869,
"cdna_end": null,
"cdna_length": 11863,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EV",
"aa_alt": "VYLQVSLSSSKYLQV?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant",
"stop_gained"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "c.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": "p.Glu1254fs",
"transcript": "ENST00000680887.1",
"protein_id": "ENSP00000505508.1",
"transcript_support_level": null,
"aa_start": 1254,
"aa_end": null,
"aa_length": 3418,
"cds_start": 3761,
"cds_end": null,
"cds_length": 10257,
"cdna_start": 3886,
"cdna_end": null,
"cdna_length": 11880,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EV",
"aa_alt": "VYLQVSLSSSKYLQV?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant",
"stop_gained"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "c.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": "p.Glu1254fs",
"transcript": "NM_001406720.1",
"protein_id": "NP_001393649.1",
"transcript_support_level": null,
"aa_start": 1254,
"aa_end": null,
"aa_length": 3401,
"cds_start": 3761,
"cds_end": null,
"cds_length": 10206,
"cdna_start": 3960,
"cdna_end": null,
"cdna_length": 11903,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EV",
"aa_alt": "VYLQVSLSSSKYLQV?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant",
"stop_gained"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "c.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": "p.Glu1254fs",
"transcript": "ENST00000700202.2",
"protein_id": "ENSP00000514856.2",
"transcript_support_level": null,
"aa_start": 1254,
"aa_end": null,
"aa_length": 3401,
"cds_start": 3761,
"cds_end": null,
"cds_length": 10206,
"cdna_start": 3960,
"cdna_end": null,
"cdna_length": 10553,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EV",
"aa_alt": "VYLQVSLSSSKYLQV?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant",
"stop_gained"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 26,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "c.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": "p.Glu1254fs",
"transcript": "NM_001406719.1",
"protein_id": "NP_001393648.1",
"transcript_support_level": null,
"aa_start": 1254,
"aa_end": null,
"aa_length": 3386,
"cds_start": 3761,
"cds_end": null,
"cds_length": 10161,
"cdna_start": 3960,
"cdna_end": null,
"cdna_length": 11858,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EV",
"aa_alt": "VYLQVSLSSSKYLQV?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant",
"stop_gained"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 26,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "c.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": "p.Glu1254fs",
"transcript": "ENST00000713680.1",
"protein_id": "ENSP00000518983.1",
"transcript_support_level": null,
"aa_start": 1254,
"aa_end": null,
"aa_length": 3366,
"cds_start": 3761,
"cds_end": null,
"cds_length": 10101,
"cdna_start": 3960,
"cdna_end": null,
"cdna_length": 11798,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EV",
"aa_alt": "VYLQVSLSSSKYLQV?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant",
"stop_gained"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "c.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": "p.Glu1254fs",
"transcript": "ENST00000713678.1",
"protein_id": "ENSP00000518981.1",
"transcript_support_level": null,
"aa_start": 1254,
"aa_end": null,
"aa_length": 3232,
"cds_start": 3761,
"cds_end": null,
"cds_length": 9699,
"cdna_start": 3972,
"cdna_end": null,
"cdna_length": 11900,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "n.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": null,
"transcript": "ENST00000470094.2",
"protein_id": "ENSP00000434898.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12077,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "n.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": null,
"transcript": "ENST00000528762.2",
"protein_id": "ENSP00000433168.2",
"transcript_support_level": 4,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 10668,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "n.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": null,
"transcript": "ENST00000665585.2",
"protein_id": "ENSP00000499570.2",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 10917,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 26,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "n.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": null,
"transcript": "ENST00000666593.2",
"protein_id": "ENSP00000499256.2",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 9839,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "n.*3400_*3403delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": null,
"transcript": "ENST00000713677.1",
"protein_id": "ENSP00000518980.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 11958,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 25,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "n.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": null,
"transcript": "ENST00000713679.1",
"protein_id": "ENSP00000518982.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 11428,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "n.3960_3963delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": null,
"transcript": "NR_176251.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12018,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "n.*3400_*3403delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": null,
"transcript": "ENST00000713677.1",
"protein_id": "ENSP00000518980.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 11958,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 26,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "c.1909+4729_1909+4732delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": null,
"transcript": "NM_001406721.1",
"protein_id": "NP_001393650.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1774,
"cds_start": -4,
"cds_end": null,
"cds_length": 5325,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7022,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"hgvs_c": "c.425-6442_425-6439delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": null,
"transcript": "NM_001406722.1",
"protein_id": "NP_001393651.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1279,
"cds_start": -4,
"cds_end": null,
"cds_length": 3840,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5800,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "BRCA2",
"gene_hgnc_id": 1101,
"dbsnp": "rs1555283391",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 1.463,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 16,
"acmg_classification": "Pathogenic",
"acmg_criteria": "PVS1,PP5_Very_Strong",
"acmg_by_gene": [
{
"score": 16,
"benign_score": 0,
"pathogenic_score": 16,
"criteria": [
"PVS1",
"PP5_Very_Strong"
],
"verdict": "Pathogenic",
"transcript": "ENST00000530893.7",
"gene_symbol": "BRCA2",
"hgnc_id": 1101,
"effects": [
"frameshift_variant",
"stop_gained"
],
"inheritance_mode": "AD,AR",
"hgvs_c": "c.3392_3395delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
"hgvs_p": "p.Glu1131fs"
}
],
"clinvar_disease": "Hereditary breast ovarian cancer syndrome,Hereditary cancer-predisposing syndrome",
"clinvar_classification": "Pathogenic",
"clinvar_review_status": "criteria provided, multiple submitters, no conflicts",
"clinvar_submissions_summary": "P:2",
"phenotype_combined": "Hereditary cancer-predisposing syndrome|Hereditary breast ovarian cancer syndrome",
"pathogenicity_classification_combined": "Pathogenic",
"custom_annotations": null
}
],
"message": null
}