← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 13-32338116-AGGT-TTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=13&pos=32338116&ref=AGGT&alt=TTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "13",
      "pos": 32338116,
      "ref": "AGGT",
      "alt": "TTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
      "effect": "frameshift_variant,stop_gained",
      "transcript": "ENST00000530893.7",
      "consequences": [
        {
          "aa_ref": "EV",
          "aa_alt": "VYLQVSLSSSKYLQV?",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant",
            "stop_gained"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 27,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "c.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": "p.Glu1254fs",
          "transcript": "NM_000059.4",
          "protein_id": "NP_000050.3",
          "transcript_support_level": null,
          "aa_start": 1254,
          "aa_end": null,
          "aa_length": 3418,
          "cds_start": 3761,
          "cds_end": null,
          "cds_length": 10257,
          "cdna_start": 3960,
          "cdna_end": null,
          "cdna_length": 11954,
          "mane_select": "ENST00000380152.8",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EV",
          "aa_alt": "VYLQVSLSSSKYLQV?",
          "canonical": true,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant",
            "stop_gained"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 27,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "c.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": "p.Glu1254fs",
          "transcript": "ENST00000380152.8",
          "protein_id": "ENSP00000369497.3",
          "transcript_support_level": 5,
          "aa_start": 1254,
          "aa_end": null,
          "aa_length": 3418,
          "cds_start": 3761,
          "cds_end": null,
          "cds_length": 10257,
          "cdna_start": 3960,
          "cdna_end": null,
          "cdna_length": 11954,
          "mane_select": "NM_000059.4",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EV",
          "aa_alt": "VYLQVSLSSSKYLQV?",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant",
            "stop_gained"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 27,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "c.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": "p.Glu1254fs",
          "transcript": "ENST00000544455.6",
          "protein_id": "ENSP00000439902.1",
          "transcript_support_level": 1,
          "aa_start": 1254,
          "aa_end": null,
          "aa_length": 3418,
          "cds_start": 3761,
          "cds_end": null,
          "cds_length": 10257,
          "cdna_start": 3860,
          "cdna_end": null,
          "cdna_length": 11854,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EV",
          "aa_alt": "VYLQVSLSSSKYLQV?",
          "canonical": true,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant",
            "stop_gained"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 27,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "c.3392_3395delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": "p.Glu1131fs",
          "transcript": "ENST00000530893.7",
          "protein_id": "ENSP00000499438.2",
          "transcript_support_level": 1,
          "aa_start": 1131,
          "aa_end": null,
          "aa_length": 3295,
          "cds_start": 3392,
          "cds_end": null,
          "cds_length": 9888,
          "cdna_start": 3959,
          "cdna_end": null,
          "cdna_length": 11953,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": true,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 10,
          "exon_rank_end": null,
          "exon_count": 26,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "n.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": null,
          "transcript": "ENST00000614259.2",
          "protein_id": "ENSP00000506251.1",
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 11763,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EV",
          "aa_alt": "VYLQVSLSSSKYLQV?",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant",
            "stop_gained"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 27,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "c.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": "p.Glu1254fs",
          "transcript": "NM_001432077.1",
          "protein_id": "NP_001419006.1",
          "transcript_support_level": null,
          "aa_start": 1254,
          "aa_end": null,
          "aa_length": 3418,
          "cds_start": 3761,
          "cds_end": null,
          "cds_length": 10257,
          "cdna_start": 3869,
          "cdna_end": null,
          "cdna_length": 11863,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EV",
          "aa_alt": "VYLQVSLSSSKYLQV?",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant",
            "stop_gained"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 27,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "c.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": "p.Glu1254fs",
          "transcript": "ENST00000680887.1",
          "protein_id": "ENSP00000505508.1",
          "transcript_support_level": null,
          "aa_start": 1254,
          "aa_end": null,
          "aa_length": 3418,
          "cds_start": 3761,
          "cds_end": null,
          "cds_length": 10257,
          "cdna_start": 3886,
          "cdna_end": null,
          "cdna_length": 11880,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EV",
          "aa_alt": "VYLQVSLSSSKYLQV?",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant",
            "stop_gained"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 27,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "c.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": "p.Glu1254fs",
          "transcript": "NM_001406720.1",
          "protein_id": "NP_001393649.1",
          "transcript_support_level": null,
          "aa_start": 1254,
          "aa_end": null,
          "aa_length": 3401,
          "cds_start": 3761,
          "cds_end": null,
          "cds_length": 10206,
          "cdna_start": 3960,
          "cdna_end": null,
          "cdna_length": 11903,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EV",
          "aa_alt": "VYLQVSLSSSKYLQV?",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant",
            "stop_gained"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 27,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "c.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": "p.Glu1254fs",
          "transcript": "ENST00000700202.2",
          "protein_id": "ENSP00000514856.2",
          "transcript_support_level": null,
          "aa_start": 1254,
          "aa_end": null,
          "aa_length": 3401,
          "cds_start": 3761,
          "cds_end": null,
          "cds_length": 10206,
          "cdna_start": 3960,
          "cdna_end": null,
          "cdna_length": 10553,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EV",
          "aa_alt": "VYLQVSLSSSKYLQV?",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant",
            "stop_gained"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 26,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "c.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": "p.Glu1254fs",
          "transcript": "NM_001406719.1",
          "protein_id": "NP_001393648.1",
          "transcript_support_level": null,
          "aa_start": 1254,
          "aa_end": null,
          "aa_length": 3386,
          "cds_start": 3761,
          "cds_end": null,
          "cds_length": 10161,
          "cdna_start": 3960,
          "cdna_end": null,
          "cdna_length": 11858,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EV",
          "aa_alt": "VYLQVSLSSSKYLQV?",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant",
            "stop_gained"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 26,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "c.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": "p.Glu1254fs",
          "transcript": "ENST00000713680.1",
          "protein_id": "ENSP00000518983.1",
          "transcript_support_level": null,
          "aa_start": 1254,
          "aa_end": null,
          "aa_length": 3366,
          "cds_start": 3761,
          "cds_end": null,
          "cds_length": 10101,
          "cdna_start": 3960,
          "cdna_end": null,
          "cdna_length": 11798,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EV",
          "aa_alt": "VYLQVSLSSSKYLQV?",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant",
            "stop_gained"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 27,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "c.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": "p.Glu1254fs",
          "transcript": "ENST00000713678.1",
          "protein_id": "ENSP00000518981.1",
          "transcript_support_level": null,
          "aa_start": 1254,
          "aa_end": null,
          "aa_length": 3232,
          "cds_start": 3761,
          "cds_end": null,
          "cds_length": 9699,
          "cdna_start": 3972,
          "cdna_end": null,
          "cdna_length": 11900,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 28,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "n.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": null,
          "transcript": "ENST00000470094.2",
          "protein_id": "ENSP00000434898.2",
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 12077,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 28,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "n.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": null,
          "transcript": "ENST00000528762.2",
          "protein_id": "ENSP00000433168.2",
          "transcript_support_level": 4,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 10668,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 29,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "n.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": null,
          "transcript": "ENST00000665585.2",
          "protein_id": "ENSP00000499570.2",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 10917,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 26,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "n.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": null,
          "transcript": "ENST00000666593.2",
          "protein_id": "ENSP00000499256.2",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 9839,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 27,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "n.*3400_*3403delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": null,
          "transcript": "ENST00000713677.1",
          "protein_id": "ENSP00000518980.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 11958,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 25,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "n.3761_3764delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": null,
          "transcript": "ENST00000713679.1",
          "protein_id": "ENSP00000518982.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 11428,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 28,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "n.3960_3963delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": null,
          "transcript": "NR_176251.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 12018,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 27,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "n.*3400_*3403delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": null,
          "transcript": "ENST00000713677.1",
          "protein_id": "ENSP00000518980.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 11958,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 26,
          "intron_rank": 10,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "c.1909+4729_1909+4732delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": null,
          "transcript": "NM_001406721.1",
          "protein_id": "NP_001393650.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 1774,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 5325,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 7022,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 24,
          "intron_rank": 8,
          "intron_rank_end": null,
          "gene_symbol": "BRCA2",
          "gene_hgnc_id": 1101,
          "hgvs_c": "c.425-6442_425-6439delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": null,
          "transcript": "NM_001406722.1",
          "protein_id": "NP_001393651.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 1279,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 3840,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 5800,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "BRCA2",
      "gene_hgnc_id": 1101,
      "dbsnp": "rs1555283391",
      "frequency_reference_population": null,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 0,
      "gnomad_exomes_af": null,
      "gnomad_genomes_af": null,
      "gnomad_exomes_ac": null,
      "gnomad_genomes_ac": null,
      "gnomad_exomes_homalt": null,
      "gnomad_genomes_homalt": null,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 1.463,
      "phylop100way_prediction": "Benign",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 16,
      "acmg_classification": "Pathogenic",
      "acmg_criteria": "PVS1,PP5_Very_Strong",
      "acmg_by_gene": [
        {
          "score": 16,
          "benign_score": 0,
          "pathogenic_score": 16,
          "criteria": [
            "PVS1",
            "PP5_Very_Strong"
          ],
          "verdict": "Pathogenic",
          "transcript": "ENST00000530893.7",
          "gene_symbol": "BRCA2",
          "hgnc_id": 1101,
          "effects": [
            "frameshift_variant",
            "stop_gained"
          ],
          "inheritance_mode": "AD,AR",
          "hgvs_c": "c.3392_3395delAGGTinsTTTATCTTCAAGTAAGTTTATCTTCAAGTAAATATCTTCAAGTAA",
          "hgvs_p": "p.Glu1131fs"
        }
      ],
      "clinvar_disease": "Hereditary breast ovarian cancer syndrome,Hereditary cancer-predisposing syndrome",
      "clinvar_classification": "Pathogenic",
      "clinvar_review_status": "criteria provided, multiple submitters, no conflicts",
      "clinvar_submissions_summary": "P:2",
      "phenotype_combined": "Hereditary cancer-predisposing syndrome|Hereditary breast ovarian cancer syndrome",
      "pathogenicity_classification_combined": "Pathogenic",
      "custom_annotations": null
    }
  ],
  "message": null
}