← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 13-99985448-AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCG-A (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=13&pos=99985448&ref=AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCG&alt=A&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "13",
"pos": 99985448,
"ref": "AGCGGCGGCGGCAGCGGCGGCGGCGGCTGCG",
"alt": "A",
"effect": "disruptive_inframe_deletion",
"transcript": "ENST00000376335.8",
"consequences": [
{
"aa_ref": "AAAAAAAAAAA",
"aa_alt": "A",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZIC2",
"gene_hgnc_id": 12873,
"hgvs_c": "c.1377_1406delAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC",
"hgvs_p": "p.Ala460_Ala469del",
"transcript": "NM_007129.5",
"protein_id": "NP_009060.2",
"transcript_support_level": null,
"aa_start": 459,
"aa_end": null,
"aa_length": 532,
"cds_start": 1377,
"cds_end": null,
"cds_length": 1599,
"cdna_start": 1658,
"cdna_end": null,
"cdna_length": 2963,
"mane_select": "ENST00000376335.8",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "AAAAAAAAAAA",
"aa_alt": "A",
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZIC2",
"gene_hgnc_id": 12873,
"hgvs_c": "c.1377_1406delAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC",
"hgvs_p": "p.Ala460_Ala469del",
"transcript": "ENST00000376335.8",
"protein_id": "ENSP00000365514.3",
"transcript_support_level": 1,
"aa_start": 459,
"aa_end": null,
"aa_length": 532,
"cds_start": 1377,
"cds_end": null,
"cds_length": 1599,
"cdna_start": 1658,
"cdna_end": null,
"cdna_length": 2963,
"mane_select": "NM_007129.5",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZIC2",
"gene_hgnc_id": 12873,
"hgvs_c": "n.351_380delAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000468291.1",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 383,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZIC2",
"gene_hgnc_id": 12873,
"hgvs_c": "n.459_*15delAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000477213.1",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 473,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZIC2",
"gene_hgnc_id": 12873,
"hgvs_c": "n.423_452delAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000490085.5",
"protein_id": null,
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 455,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZIC2",
"gene_hgnc_id": 12873,
"hgvs_c": "n.-45_-16delGCGGCGGCGGCAGCGGCGGCGGCGGCTGCG",
"hgvs_p": null,
"transcript": "ENST00000481565.1",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 218,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZIC2",
"gene_hgnc_id": 12873,
"hgvs_c": "n.448_*4delGCGGCGGCGGCAGCGGCGGCGGCGGCTGCG",
"hgvs_p": null,
"transcript": "ENST00000477213.1",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 473,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "ZIC2",
"gene_hgnc_id": 12873,
"dbsnp": "rs756225250",
"frequency_reference_population": 0.000078305886,
"hom_count_reference_population": 1,
"allele_count_reference_population": 111,
"gnomad_exomes_af": 0.0000805289,
"gnomad_genomes_af": 0.0000596453,
"gnomad_exomes_ac": 102,
"gnomad_genomes_ac": 9,
"gnomad_exomes_homalt": 1,
"gnomad_genomes_homalt": 0,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 5.219,
"phylop100way_prediction": "Uncertain_significance",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": -1,
"acmg_classification": "Likely_benign",
"acmg_criteria": "BP3",
"acmg_by_gene": [
{
"score": -1,
"benign_score": 1,
"pathogenic_score": 0,
"criteria": [
"BP3"
],
"verdict": "Likely_benign",
"transcript": "ENST00000376335.8",
"gene_symbol": "ZIC2",
"hgnc_id": 12873,
"effects": [
"disruptive_inframe_deletion"
],
"inheritance_mode": "AD,AR",
"hgvs_c": "c.1377_1406delAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC",
"hgvs_p": "p.Ala460_Ala469del"
}
],
"clinvar_disease": "Holoprosencephaly 5",
"clinvar_classification": "Uncertain significance",
"clinvar_review_status": "criteria provided, multiple submitters, no conflicts",
"clinvar_submissions_summary": "US:2",
"phenotype_combined": "Holoprosencephaly 5",
"pathogenicity_classification_combined": "Uncertain significance",
"custom_annotations": null
}
],
"message": null
}