← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 15-22786677-A-AGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=15&pos=22786677&ref=A&alt=AGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "15",
"pos": 22786677,
"ref": "A",
"alt": "AGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG",
"effect": "disruptive_inframe_insertion",
"transcript": "ENST00000337435.9",
"consequences": [
{
"aa_ref": "A",
"aa_alt": "AAAAAAAAAAAAAA",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NIPA1",
"gene_hgnc_id": 17043,
"hgvs_c": "c.47_48insGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ala16_Gly17insAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAla",
"transcript": "NM_144599.5",
"protein_id": "NP_653200.2",
"transcript_support_level": null,
"aa_start": 16,
"aa_end": null,
"aa_length": 329,
"cds_start": 48,
"cds_end": null,
"cds_length": 990,
"cdna_start": 61,
"cdna_end": null,
"cdna_length": 6553,
"mane_select": "ENST00000337435.9",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "A",
"aa_alt": "AAAAAAAAAAAAAA",
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NIPA1",
"gene_hgnc_id": 17043,
"hgvs_c": "c.47_48insGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ala16_Gly17insAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAla",
"transcript": "ENST00000337435.9",
"protein_id": "ENSP00000337452.4",
"transcript_support_level": 1,
"aa_start": 16,
"aa_end": null,
"aa_length": 329,
"cds_start": 48,
"cds_end": null,
"cds_length": 990,
"cdna_start": 61,
"cdna_end": null,
"cdna_length": 6553,
"mane_select": "NM_144599.5",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "NIPA1",
"gene_hgnc_id": 17043,
"hgvs_c": "c.-48+12390_-48+12391insGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000437912.6",
"protein_id": "ENSP00000393962.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 254,
"cds_start": -4,
"cds_end": null,
"cds_length": 765,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7613,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "NIPA1",
"gene_hgnc_id": 17043,
"hgvs_c": "c.-48+455_-48+456insGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000561183.5",
"protein_id": "ENSP00000453722.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 254,
"cds_start": -4,
"cds_end": null,
"cds_length": 765,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1675,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "NIPA1",
"gene_hgnc_id": 17043,
"hgvs_c": "c.-48+455_-48+456insGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "NM_001142275.1",
"protein_id": "NP_001135747.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 254,
"cds_start": -4,
"cds_end": null,
"cds_length": 765,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6386,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "NIPA1",
"gene_hgnc_id": 17043,
"hgvs_c": "n.31+455_31+456insGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC",
"hgvs_p": null,
"transcript": "ENST00000560069.5",
"protein_id": null,
"transcript_support_level": 4,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 575,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NIPA1",
"gene_hgnc_id": 17043,
"hgvs_c": "n.-136_-135insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG",
"hgvs_p": null,
"transcript": "ENST00000557930.1",
"protein_id": "ENSP00000453797.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 582,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NIPA1",
"gene_hgnc_id": 17043,
"hgvs_c": "n.-91_-90insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG",
"hgvs_p": null,
"transcript": "ENST00000559448.5",
"protein_id": "ENSP00000453286.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2799,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NIPA1",
"gene_hgnc_id": 17043,
"hgvs_c": "n.-81_-80insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG",
"hgvs_p": null,
"transcript": "ENST00000560105.1",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 375,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "NIPA1",
"gene_hgnc_id": 17043,
"dbsnp": "rs531550505",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 1.48,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": -1,
"acmg_classification": "Likely_benign",
"acmg_criteria": "BP3",
"acmg_by_gene": [
{
"score": -1,
"benign_score": 1,
"pathogenic_score": 0,
"criteria": [
"BP3"
],
"verdict": "Likely_benign",
"transcript": "ENST00000337435.9",
"gene_symbol": "NIPA1",
"hgnc_id": 17043,
"effects": [
"disruptive_inframe_insertion"
],
"inheritance_mode": "AD",
"hgvs_c": "c.47_48insGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC",
"hgvs_p": "p.Ala16_Gly17insAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAla"
}
],
"clinvar_disease": "Amyotrophic lateral sclerosis",
"clinvar_classification": "risk factor",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "O:1",
"phenotype_combined": "Amyotrophic lateral sclerosis",
"pathogenicity_classification_combined": "risk factor",
"custom_annotations": null
}
],
"message": null
}