← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 16-2088525-CTCCAGCCGAGCCCACACCTGGCTATGAGGTGG-C (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=16&pos=2088525&ref=CTCCAGCCGAGCCCACACCTGGCTATGAGGTGG&alt=C&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "16",
"pos": 2088525,
"ref": "CTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"alt": "C",
"effect": "frameshift_variant",
"transcript": "ENST00000219476.9",
"consequences": [
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 42,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5340_5371delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1784fs",
"transcript": "NM_000548.5",
"protein_id": "NP_000539.2",
"transcript_support_level": null,
"aa_start": 1780,
"aa_end": null,
"aa_length": 1807,
"cds_start": 5340,
"cds_end": null,
"cds_length": 5424,
"cdna_start": 5450,
"cdna_end": null,
"cdna_length": 6415,
"mane_select": "ENST00000219476.9",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 42,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5340_5371delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1784fs",
"transcript": "ENST00000219476.9",
"protein_id": "ENSP00000219476.3",
"transcript_support_level": 5,
"aa_start": 1780,
"aa_end": null,
"aa_length": 1807,
"cds_start": 5340,
"cds_end": null,
"cds_length": 5424,
"cdna_start": 5450,
"cdna_end": null,
"cdna_length": 6415,
"mane_select": "NM_000548.5",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 41,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5271_5302delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1761fs",
"transcript": "ENST00000350773.9",
"protein_id": "ENSP00000344383.4",
"transcript_support_level": 1,
"aa_start": 1757,
"aa_end": null,
"aa_length": 1784,
"cds_start": 5271,
"cds_end": null,
"cds_length": 5355,
"cdna_start": 5346,
"cdna_end": null,
"cdna_length": 5538,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5139_5170delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1717fs",
"transcript": "ENST00000401874.7",
"protein_id": "ENSP00000384468.2",
"transcript_support_level": 1,
"aa_start": 1713,
"aa_end": null,
"aa_length": 1740,
"cds_start": 5139,
"cds_end": null,
"cds_length": 5223,
"cdna_start": 5245,
"cdna_end": null,
"cdna_length": 5437,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 38,
"exon_rank_end": null,
"exon_count": 38,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.*4507_*4538delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "ENST00000439117.6",
"protein_id": "ENSP00000406980.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5073,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 38,
"exon_rank_end": null,
"exon_count": 38,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.*4507_*4538delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "ENST00000439117.6",
"protein_id": "ENSP00000406980.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5073,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 42,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5430_5461delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1814fs",
"transcript": "ENST00000645186.2",
"protein_id": "ENSP00000495110.2",
"transcript_support_level": null,
"aa_start": 1810,
"aa_end": null,
"aa_length": 1837,
"cds_start": 5430,
"cds_end": null,
"cds_length": 5514,
"cdna_start": 5540,
"cdna_end": null,
"cdna_length": 6505,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 42,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5337_5368delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1783fs",
"transcript": "NM_001406663.1",
"protein_id": "NP_001393592.1",
"transcript_support_level": null,
"aa_start": 1779,
"aa_end": null,
"aa_length": 1806,
"cds_start": 5337,
"cds_end": null,
"cds_length": 5421,
"cdna_start": 5447,
"cdna_end": null,
"cdna_length": 6412,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 42,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5337_5368delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1783fs",
"transcript": "ENST00000642365.2",
"protein_id": "ENSP00000495459.2",
"transcript_support_level": null,
"aa_start": 1779,
"aa_end": null,
"aa_length": 1806,
"cds_start": 5337,
"cds_end": null,
"cds_length": 5421,
"cdna_start": 5408,
"cdna_end": null,
"cdna_length": 5574,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 42,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5334_5365delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1782fs",
"transcript": "ENST00000646388.1",
"protein_id": "ENSP00000495921.1",
"transcript_support_level": null,
"aa_start": 1778,
"aa_end": null,
"aa_length": 1805,
"cds_start": 5334,
"cds_end": null,
"cds_length": 5418,
"cdna_start": 5420,
"cdna_end": null,
"cdna_length": 5614,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 41,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5271_5302delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1761fs",
"transcript": "NM_001114382.3",
"protein_id": "NP_001107854.1",
"transcript_support_level": null,
"aa_start": 1757,
"aa_end": null,
"aa_length": 1784,
"cds_start": 5271,
"cds_end": null,
"cds_length": 5355,
"cdna_start": 5381,
"cdna_end": null,
"cdna_length": 6346,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 41,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5268_5299delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1760fs",
"transcript": "NM_001406664.1",
"protein_id": "NP_001393593.1",
"transcript_support_level": null,
"aa_start": 1756,
"aa_end": null,
"aa_length": 1783,
"cds_start": 5268,
"cds_end": null,
"cds_length": 5352,
"cdna_start": 5378,
"cdna_end": null,
"cdna_length": 6343,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 41,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5265_5296delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1759fs",
"transcript": "ENST00000643946.1",
"protein_id": "ENSP00000495927.1",
"transcript_support_level": null,
"aa_start": 1755,
"aa_end": null,
"aa_length": 1782,
"cds_start": 5265,
"cds_end": null,
"cds_length": 5349,
"cdna_start": 5383,
"cdna_end": null,
"cdna_length": 6344,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 41,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5262_5293delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1758fs",
"transcript": "NM_001406665.1",
"protein_id": "NP_001393594.1",
"transcript_support_level": null,
"aa_start": 1754,
"aa_end": null,
"aa_length": 1781,
"cds_start": 5262,
"cds_end": null,
"cds_length": 5346,
"cdna_start": 5372,
"cdna_end": null,
"cdna_length": 6337,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5259_5290delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1757fs",
"transcript": "ENST00000644399.1",
"protein_id": "ENSP00000493990.1",
"transcript_support_level": null,
"aa_start": 1753,
"aa_end": null,
"aa_length": 1780,
"cds_start": 5259,
"cds_end": null,
"cds_length": 5343,
"cdna_start": 5261,
"cdna_end": null,
"cdna_length": 5445,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5232_5263delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1748fs",
"transcript": "NM_001406667.1",
"protein_id": "NP_001393596.1",
"transcript_support_level": null,
"aa_start": 1744,
"aa_end": null,
"aa_length": 1771,
"cds_start": 5232,
"cds_end": null,
"cds_length": 5316,
"cdna_start": 5342,
"cdna_end": null,
"cdna_length": 6307,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5229_5260delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1747fs",
"transcript": "NM_001406668.1",
"protein_id": "NP_001393597.1",
"transcript_support_level": null,
"aa_start": 1743,
"aa_end": null,
"aa_length": 1770,
"cds_start": 5229,
"cds_end": null,
"cds_length": 5313,
"cdna_start": 5339,
"cdna_end": null,
"cdna_length": 6304,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 39,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5226_5257delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1746fs",
"transcript": "ENST00000644329.1",
"protein_id": "ENSP00000496611.1",
"transcript_support_level": null,
"aa_start": 1742,
"aa_end": null,
"aa_length": 1769,
"cds_start": 5226,
"cds_end": null,
"cds_length": 5310,
"cdna_start": 5288,
"cdna_end": null,
"cdna_length": 5453,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 41,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5211_5242delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1741fs",
"transcript": "NM_021055.3",
"protein_id": "NP_066399.2",
"transcript_support_level": null,
"aa_start": 1737,
"aa_end": null,
"aa_length": 1764,
"cds_start": 5211,
"cds_end": null,
"cds_length": 5295,
"cdna_start": 5321,
"cdna_end": null,
"cdna_length": 6286,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 41,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5211_5242delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1741fs",
"transcript": "ENST00000644043.1",
"protein_id": "ENSP00000496262.1",
"transcript_support_level": null,
"aa_start": 1737,
"aa_end": null,
"aa_length": 1764,
"cds_start": 5211,
"cds_end": null,
"cds_length": 5295,
"cdna_start": 5265,
"cdna_end": null,
"cdna_length": 5457,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 41,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5208_5239delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1740fs",
"transcript": "NM_001370404.1",
"protein_id": "NP_001357333.1",
"transcript_support_level": null,
"aa_start": 1736,
"aa_end": null,
"aa_length": 1763,
"cds_start": 5208,
"cds_end": null,
"cds_length": 5292,
"cdna_start": 5318,
"cdna_end": null,
"cdna_length": 6283,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 41,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5208_5239delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1740fs",
"transcript": "ENST00000642936.1",
"protein_id": "ENSP00000494514.1",
"transcript_support_level": null,
"aa_start": 1736,
"aa_end": null,
"aa_length": 1763,
"cds_start": 5208,
"cds_end": null,
"cds_length": 5292,
"cdna_start": 5317,
"cdna_end": null,
"cdna_length": 5507,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 41,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5199_5230delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1737fs",
"transcript": "NM_001370405.1",
"protein_id": "NP_001357334.1",
"transcript_support_level": null,
"aa_start": 1733,
"aa_end": null,
"aa_length": 1760,
"cds_start": 5199,
"cds_end": null,
"cds_length": 5283,
"cdna_start": 5309,
"cdna_end": null,
"cdna_length": 6274,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 41,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5199_5230delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1737fs",
"transcript": "ENST00000642561.1",
"protein_id": "ENSP00000495099.1",
"transcript_support_level": null,
"aa_start": 1733,
"aa_end": null,
"aa_length": 1760,
"cds_start": 5199,
"cds_end": null,
"cds_length": 5283,
"cdna_start": 5251,
"cdna_end": null,
"cdna_length": 5396,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5187_5218delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1733fs",
"transcript": "ENST00000642206.2",
"protein_id": "ENSP00000495146.2",
"transcript_support_level": null,
"aa_start": 1729,
"aa_end": null,
"aa_length": 1756,
"cds_start": 5187,
"cds_end": null,
"cds_length": 5271,
"cdna_start": 5303,
"cdna_end": null,
"cdna_length": 5485,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5172_5203delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1728fs",
"transcript": "NM_001318832.2",
"protein_id": "NP_001305761.1",
"transcript_support_level": null,
"aa_start": 1724,
"aa_end": null,
"aa_length": 1751,
"cds_start": 5172,
"cds_end": null,
"cds_length": 5256,
"cdna_start": 5240,
"cdna_end": null,
"cdna_length": 6205,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5172_5203delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1728fs",
"transcript": "ENST00000568454.6",
"protein_id": "ENSP00000454487.1",
"transcript_support_level": 2,
"aa_start": 1724,
"aa_end": null,
"aa_length": 1751,
"cds_start": 5172,
"cds_end": null,
"cds_length": 5256,
"cdna_start": 5240,
"cdna_end": null,
"cdna_length": 5429,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5160_5191delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1724fs",
"transcript": "NM_001406670.1",
"protein_id": "NP_001393599.1",
"transcript_support_level": null,
"aa_start": 1720,
"aa_end": null,
"aa_length": 1747,
"cds_start": 5160,
"cds_end": null,
"cds_length": 5244,
"cdna_start": 5270,
"cdna_end": null,
"cdna_length": 6235,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5142_5173delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1718fs",
"transcript": "NM_001363528.2",
"protein_id": "NP_001350457.1",
"transcript_support_level": null,
"aa_start": 1714,
"aa_end": null,
"aa_length": 1741,
"cds_start": 5142,
"cds_end": null,
"cds_length": 5226,
"cdna_start": 5252,
"cdna_end": null,
"cdna_length": 6217,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5142_5173delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1718fs",
"transcript": "ENST00000642797.1",
"protein_id": "ENSP00000493846.1",
"transcript_support_level": null,
"aa_start": 1714,
"aa_end": null,
"aa_length": 1741,
"cds_start": 5142,
"cds_end": null,
"cds_length": 5226,
"cdna_start": 5196,
"cdna_end": null,
"cdna_length": 5388,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5139_5170delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1717fs",
"transcript": "NM_001077183.3",
"protein_id": "NP_001070651.1",
"transcript_support_level": null,
"aa_start": 1713,
"aa_end": null,
"aa_length": 1740,
"cds_start": 5139,
"cds_end": null,
"cds_length": 5223,
"cdna_start": 5249,
"cdna_end": null,
"cdna_length": 6214,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5136_5167delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1716fs",
"transcript": "ENST00000644335.1",
"protein_id": "ENSP00000496317.1",
"transcript_support_level": null,
"aa_start": 1712,
"aa_end": null,
"aa_length": 1739,
"cds_start": 5136,
"cds_end": null,
"cds_length": 5220,
"cdna_start": 5236,
"cdna_end": null,
"cdna_length": 5433,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5133_5164delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1715fs",
"transcript": "ENST00000643088.1",
"protein_id": "ENSP00000494747.1",
"transcript_support_level": null,
"aa_start": 1711,
"aa_end": null,
"aa_length": 1738,
"cds_start": 5133,
"cds_end": null,
"cds_length": 5217,
"cdna_start": 5251,
"cdna_end": null,
"cdna_length": 5970,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5130_5161delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1714fs",
"transcript": "NM_001406671.1",
"protein_id": "NP_001393600.1",
"transcript_support_level": null,
"aa_start": 1710,
"aa_end": null,
"aa_length": 1737,
"cds_start": 5130,
"cds_end": null,
"cds_length": 5214,
"cdna_start": 5240,
"cdna_end": null,
"cdna_length": 6205,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5127_5158delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1713fs",
"transcript": "NM_001406673.1",
"protein_id": "NP_001393602.1",
"transcript_support_level": null,
"aa_start": 1709,
"aa_end": null,
"aa_length": 1736,
"cds_start": 5127,
"cds_end": null,
"cds_length": 5211,
"cdna_start": 5237,
"cdna_end": null,
"cdna_length": 6202,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5124_5155delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1712fs",
"transcript": "NM_001406675.1",
"protein_id": "NP_001393604.1",
"transcript_support_level": null,
"aa_start": 1708,
"aa_end": null,
"aa_length": 1735,
"cds_start": 5124,
"cds_end": null,
"cds_length": 5208,
"cdna_start": 5214,
"cdna_end": null,
"cdna_length": 6179,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5121_5152delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1711fs",
"transcript": "NM_001406676.1",
"protein_id": "NP_001393605.1",
"transcript_support_level": null,
"aa_start": 1707,
"aa_end": null,
"aa_length": 1734,
"cds_start": 5121,
"cds_end": null,
"cds_length": 5205,
"cdna_start": 5211,
"cdna_end": null,
"cdna_length": 6176,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 39,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5082_5113delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1698fs",
"transcript": "NM_001406677.1",
"protein_id": "NP_001393606.1",
"transcript_support_level": null,
"aa_start": 1694,
"aa_end": null,
"aa_length": 1721,
"cds_start": 5082,
"cds_end": null,
"cds_length": 5166,
"cdna_start": 5172,
"cdna_end": null,
"cdna_length": 6137,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 39,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5031_5062delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1681fs",
"transcript": "NM_001318827.2",
"protein_id": "NP_001305756.1",
"transcript_support_level": null,
"aa_start": 1677,
"aa_end": null,
"aa_length": 1704,
"cds_start": 5031,
"cds_end": null,
"cds_length": 5115,
"cdna_start": 5141,
"cdna_end": null,
"cdna_length": 6106,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 39,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5031_5062delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1681fs",
"transcript": "ENST00000439673.6",
"protein_id": "ENSP00000399232.2",
"transcript_support_level": 2,
"aa_start": 1677,
"aa_end": null,
"aa_length": 1704,
"cds_start": 5031,
"cds_end": null,
"cds_length": 5115,
"cdna_start": 5112,
"cdna_end": null,
"cdna_length": 5287,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 39,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5028_5059delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1680fs",
"transcript": "NM_001406678.1",
"protein_id": "NP_001393607.1",
"transcript_support_level": null,
"aa_start": 1676,
"aa_end": null,
"aa_length": 1703,
"cds_start": 5028,
"cds_end": null,
"cds_length": 5112,
"cdna_start": 5138,
"cdna_end": null,
"cdna_length": 6103,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 39,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.4995_5026delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1669fs",
"transcript": "NM_001318829.2",
"protein_id": "NP_001305758.1",
"transcript_support_level": null,
"aa_start": 1665,
"aa_end": null,
"aa_length": 1692,
"cds_start": 4995,
"cds_end": null,
"cds_length": 5079,
"cdna_start": 5085,
"cdna_end": null,
"cdna_length": 6050,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 39,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.4995_5026delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1669fs",
"transcript": "ENST00000382538.10",
"protein_id": "ENSP00000371978.6",
"transcript_support_level": 2,
"aa_start": 1665,
"aa_end": null,
"aa_length": 1692,
"cds_start": 4995,
"cds_end": null,
"cds_length": 5079,
"cdna_start": 5090,
"cdna_end": null,
"cdna_length": 5264,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 39,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.4992_5023delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1668fs",
"transcript": "NM_001406679.1",
"protein_id": "NP_001393608.1",
"transcript_support_level": null,
"aa_start": 1664,
"aa_end": null,
"aa_length": 1691,
"cds_start": 4992,
"cds_end": null,
"cds_length": 5076,
"cdna_start": 5082,
"cdna_end": null,
"cdna_length": 6047,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 42,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.4740_4771delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1584fs",
"transcript": "NM_001406680.1",
"protein_id": "NP_001393609.1",
"transcript_support_level": null,
"aa_start": 1580,
"aa_end": null,
"aa_length": 1607,
"cds_start": 4740,
"cds_end": null,
"cds_length": 4824,
"cdna_start": 5666,
"cdna_end": null,
"cdna_length": 6631,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.4680_4711delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1564fs",
"transcript": "NM_001406681.1",
"protein_id": "NP_001393610.1",
"transcript_support_level": null,
"aa_start": 1560,
"aa_end": null,
"aa_length": 1587,
"cds_start": 4680,
"cds_end": null,
"cds_length": 4764,
"cdna_start": 5235,
"cdna_end": null,
"cdna_length": 6200,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 38,
"exon_rank_end": null,
"exon_count": 38,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.4671_4702delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1561fs",
"transcript": "NM_001406682.1",
"protein_id": "NP_001393611.1",
"transcript_support_level": null,
"aa_start": 1557,
"aa_end": null,
"aa_length": 1584,
"cds_start": 4671,
"cds_end": null,
"cds_length": 4755,
"cdna_start": 5007,
"cdna_end": null,
"cdna_length": 5972,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 41,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.4671_4702delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1561fs",
"transcript": "NM_001406683.1",
"protein_id": "NP_001393612.1",
"transcript_support_level": null,
"aa_start": 1557,
"aa_end": null,
"aa_length": 1584,
"cds_start": 4671,
"cds_end": null,
"cds_length": 4755,
"cdna_start": 5597,
"cdna_end": null,
"cdna_length": 6562,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 38,
"exon_rank_end": null,
"exon_count": 38,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.4668_4699delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1560fs",
"transcript": "NM_001406684.1",
"protein_id": "NP_001393613.1",
"transcript_support_level": null,
"aa_start": 1556,
"aa_end": null,
"aa_length": 1583,
"cds_start": 4668,
"cds_end": null,
"cds_length": 4752,
"cdna_start": 5004,
"cdna_end": null,
"cdna_length": 5969,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 38,
"exon_rank_end": null,
"exon_count": 38,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.4608_4639delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1540fs",
"transcript": "NM_001318831.2",
"protein_id": "NP_001305760.1",
"transcript_support_level": null,
"aa_start": 1536,
"aa_end": null,
"aa_length": 1563,
"cds_start": 4608,
"cds_end": null,
"cds_length": 4692,
"cdna_start": 4944,
"cdna_end": null,
"cdna_length": 5909,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 37,
"exon_rank_end": null,
"exon_count": 37,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.4542_4573delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1518fs",
"transcript": "NM_001406685.1",
"protein_id": "NP_001393614.1",
"transcript_support_level": null,
"aa_start": 1514,
"aa_end": null,
"aa_length": 1541,
"cds_start": 4542,
"cds_end": null,
"cds_length": 4626,
"cdna_start": 4878,
"cdna_end": null,
"cdna_length": 5843,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 36,
"exon_rank_end": null,
"exon_count": 36,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.4542_4573delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1518fs",
"transcript": "NM_001406686.1",
"protein_id": "NP_001393615.1",
"transcript_support_level": null,
"aa_start": 1514,
"aa_end": null,
"aa_length": 1541,
"cds_start": 4542,
"cds_end": null,
"cds_length": 4626,
"cdna_start": 4711,
"cdna_end": null,
"cdna_length": 5676,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.4539_4570delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1517fs",
"transcript": "NM_001406687.1",
"protein_id": "NP_001393616.1",
"transcript_support_level": null,
"aa_start": 1513,
"aa_end": null,
"aa_length": 1540,
"cds_start": 4539,
"cds_end": null,
"cds_length": 4623,
"cdna_start": 5465,
"cdna_end": null,
"cdna_length": 6430,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 37,
"exon_rank_end": null,
"exon_count": 37,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.4539_4570delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1517fs",
"transcript": "NM_001406688.1",
"protein_id": "NP_001393617.1",
"transcript_support_level": null,
"aa_start": 1513,
"aa_end": null,
"aa_length": 1540,
"cds_start": 4539,
"cds_end": null,
"cds_length": 4623,
"cdna_start": 4875,
"cdna_end": null,
"cdna_length": 5840,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 42,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.3927_3958delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1313fs",
"transcript": "NM_001406689.1",
"protein_id": "NP_001393618.1",
"transcript_support_level": null,
"aa_start": 1309,
"aa_end": null,
"aa_length": 1336,
"cds_start": 3927,
"cds_end": null,
"cds_length": 4011,
"cdna_start": 5468,
"cdna_end": null,
"cdna_length": 6433,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 42,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.3867_3898delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1293fs",
"transcript": "NM_001406690.1",
"protein_id": "NP_001393619.1",
"transcript_support_level": null,
"aa_start": 1289,
"aa_end": null,
"aa_length": 1316,
"cds_start": 3867,
"cds_end": null,
"cds_length": 3951,
"cdna_start": 5408,
"cdna_end": null,
"cdna_length": 6373,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 42,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.3864_3895delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1292fs",
"transcript": "NM_001406691.1",
"protein_id": "NP_001393620.1",
"transcript_support_level": null,
"aa_start": 1288,
"aa_end": null,
"aa_length": 1315,
"cds_start": 3864,
"cds_end": null,
"cds_length": 3948,
"cdna_start": 5405,
"cdna_end": null,
"cdna_length": 6370,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 41,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.3798_3829delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1270fs",
"transcript": "NM_001406692.1",
"protein_id": "NP_001393621.1",
"transcript_support_level": null,
"aa_start": 1266,
"aa_end": null,
"aa_length": 1293,
"cds_start": 3798,
"cds_end": null,
"cds_length": 3882,
"cdna_start": 5339,
"cdna_end": null,
"cdna_length": 6304,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 41,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.3798_3829delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1270fs",
"transcript": "NM_001406693.1",
"protein_id": "NP_001393622.1",
"transcript_support_level": null,
"aa_start": 1266,
"aa_end": null,
"aa_length": 1293,
"cds_start": 3798,
"cds_end": null,
"cds_length": 3882,
"cdna_start": 5645,
"cdna_end": null,
"cdna_length": 6610,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.3798_3829delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1270fs",
"transcript": "NM_001406694.1",
"protein_id": "NP_001393623.1",
"transcript_support_level": null,
"aa_start": 1266,
"aa_end": null,
"aa_length": 1293,
"cds_start": 3798,
"cds_end": null,
"cds_length": 3882,
"cdna_start": 5220,
"cdna_end": null,
"cdna_length": 6185,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.3795_3826delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1269fs",
"transcript": "NM_001406695.1",
"protein_id": "NP_001393624.1",
"transcript_support_level": null,
"aa_start": 1265,
"aa_end": null,
"aa_length": 1292,
"cds_start": 3795,
"cds_end": null,
"cds_length": 3879,
"cdna_start": 5217,
"cdna_end": null,
"cdna_length": 6182,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 41,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.3795_3826delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1269fs",
"transcript": "NM_001406696.1",
"protein_id": "NP_001393625.1",
"transcript_support_level": null,
"aa_start": 1265,
"aa_end": null,
"aa_length": 1292,
"cds_start": 3795,
"cds_end": null,
"cds_length": 3879,
"cdna_start": 5324,
"cdna_end": null,
"cdna_length": 6289,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 41,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.3795_3826delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1269fs",
"transcript": "NM_001406697.1",
"protein_id": "NP_001393626.1",
"transcript_support_level": null,
"aa_start": 1265,
"aa_end": null,
"aa_length": 1292,
"cds_start": 3795,
"cds_end": null,
"cds_length": 3879,
"cdna_start": 5336,
"cdna_end": null,
"cdna_length": 6301,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.3537_3568delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1183fs",
"transcript": "NM_001406698.1",
"protein_id": "NP_001393627.1",
"transcript_support_level": null,
"aa_start": 1179,
"aa_end": null,
"aa_length": 1206,
"cds_start": 3537,
"cds_end": null,
"cds_length": 3621,
"cdna_start": 5254,
"cdna_end": null,
"cdna_length": 6219,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 42,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5394_5425delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1802fs",
"transcript": "XM_011522636.3",
"protein_id": "XP_011520938.1",
"transcript_support_level": null,
"aa_start": 1798,
"aa_end": null,
"aa_length": 1825,
"cds_start": 5394,
"cds_end": null,
"cds_length": 5478,
"cdna_start": 5504,
"cdna_end": null,
"cdna_length": 6469,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 42,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5391_5422delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1801fs",
"transcript": "XM_011522637.3",
"protein_id": "XP_011520939.1",
"transcript_support_level": null,
"aa_start": 1797,
"aa_end": null,
"aa_length": 1824,
"cds_start": 5391,
"cds_end": null,
"cds_length": 5475,
"cdna_start": 5501,
"cdna_end": null,
"cdna_length": 6466,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 41,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5283_5314delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1765fs",
"transcript": "XM_011522638.3",
"protein_id": "XP_011520940.3",
"transcript_support_level": null,
"aa_start": 1761,
"aa_end": null,
"aa_length": 1788,
"cds_start": 5283,
"cds_end": null,
"cds_length": 5367,
"cdna_start": 5393,
"cdna_end": null,
"cdna_length": 6358,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "TPAEPTPGYEVG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 41,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.5265_5296delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1759fs",
"transcript": "XM_011522639.3",
"protein_id": "XP_011520941.1",
"transcript_support_level": null,
"aa_start": 1755,
"aa_end": null,
"aa_length": 1782,
"cds_start": 5265,
"cds_end": null,
"cds_length": 5349,
"cdna_start": 5375,
"cdna_end": null,
"cdna_length": 6340,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 15,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.3063_3094delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "ENST00000497886.5",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3248,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 39,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.*3689_*3720delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "ENST00000568566.6",
"protein_id": "ENSP00000455997.2",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5350,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.*614_*645delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "ENST00000569110.2",
"protein_id": "ENSP00000455817.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1727,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.3222_3253delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "ENST00000569930.2",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3388,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.937_968delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "ENST00000642791.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1855,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.2988_3019delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "ENST00000643426.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3123,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 42,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.*5853_*5884delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "ENST00000644417.2",
"protein_id": "ENSP00000493912.2",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6666,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 23,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.3424_3455delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "ENST00000645024.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3475,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 35,
"exon_rank_end": null,
"exon_count": 35,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.*8089_*8120delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "ENST00000646464.2",
"protein_id": "ENSP00000496610.2",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8598,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 30,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.4155_4186delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "ENST00000646634.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4321,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 13,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.2592_2623delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "ENST00000646674.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2710,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 15,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.2563_2594delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "ENST00000647042.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2729,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.2453_2484delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "ENST00000647180.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2617,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 39,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.6117_6148delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "ENST00000715163.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6283,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.5292_5323delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "NR_176225.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6257,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 42,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.5540_5571delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "NR_176226.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6505,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 41,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.5468_5499delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "NR_176227.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6433,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.5289_5320delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "NR_176228.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6254,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.5214_5245delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "NR_176229.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6179,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 39,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.*3689_*3720delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "ENST00000568566.6",
"protein_id": "ENSP00000455997.2",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5350,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.*614_*645delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "ENST00000569110.2",
"protein_id": "ENSP00000455817.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1727,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 42,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.*5853_*5884delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "ENST00000644417.2",
"protein_id": "ENSP00000493912.2",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6666,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 35,
"exon_rank_end": null,
"exon_count": 35,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.*8089_*8120delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": null,
"transcript": "ENST00000646464.2",
"protein_id": "ENSP00000496610.2",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8598,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 46,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKD1",
"gene_hgnc_id": 9008,
"hgvs_c": "c.*1170_*1201delCCACCTCATAGCCAGGTGTGGGCTCGGCTGGA",
"hgvs_p": null,
"transcript": "NM_001009944.3",
"protein_id": "NP_001009944.3",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 4303,
"cds_start": -4,
"cds_end": null,
"cds_length": 12912,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 14140,
"mane_select": "ENST00000262304.9",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 46,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKD1",
"gene_hgnc_id": 9008,
"hgvs_c": "c.*1170_*1201delCCACCTCATAGCCAGGTGTGGGCTCGGCTGGA",
"hgvs_p": null,
"transcript": "ENST00000262304.9",
"protein_id": "ENSP00000262304.4",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 4303,
"cds_start": -4,
"cds_end": null,
"cds_length": 12912,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 14140,
"mane_select": "NM_001009944.3",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 46,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKD1",
"gene_hgnc_id": 9008,
"hgvs_c": "c.*1170_*1201delCCACCTCATAGCCAGGTGTGGGCTCGGCTGGA",
"hgvs_p": null,
"transcript": "ENST00000423118.5",
"protein_id": "ENSP00000399501.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 4302,
"cds_start": -4,
"cds_end": null,
"cds_length": 12909,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 14135,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 46,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKD1",
"gene_hgnc_id": 9008,
"hgvs_c": "c.*1170_*1201delCCACCTCATAGCCAGGTGTGGGCTCGGCTGGA",
"hgvs_p": null,
"transcript": "NM_000296.4",
"protein_id": "NP_000287.4",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 4302,
"cds_start": -4,
"cds_end": null,
"cds_length": 12909,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 14137,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 48,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKD1",
"gene_hgnc_id": 9008,
"hgvs_c": "c.*1170_*1201delCCACCTCATAGCCAGGTGTGGGCTCGGCTGGA",
"hgvs_p": null,
"transcript": "XM_047434208.1",
"protein_id": "XP_047290164.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 4348,
"cds_start": -4,
"cds_end": null,
"cds_length": 13047,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 14275,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 47,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKD1",
"gene_hgnc_id": 9008,
"hgvs_c": "c.*1170_*1201delCCACCTCATAGCCAGGTGTGGGCTCGGCTGGA",
"hgvs_p": null,
"transcript": "XM_047434209.1",
"protein_id": "XP_047290165.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 4324,
"cds_start": -4,
"cds_end": null,
"cds_length": 12975,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 14203,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 47,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKD1",
"gene_hgnc_id": 9008,
"hgvs_c": "c.*1170_*1201delCCACCTCATAGCCAGGTGTGGGCTCGGCTGGA",
"hgvs_p": null,
"transcript": "XM_011522528.4",
"protein_id": "XP_011520830.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 4321,
"cds_start": -4,
"cds_end": null,
"cds_length": 12966,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 14174,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 47,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKD1",
"gene_hgnc_id": 9008,
"hgvs_c": "c.*1170_*1201delCCACCTCATAGCCAGGTGTGGGCTCGGCTGGA",
"hgvs_p": null,
"transcript": "XM_011522529.3",
"protein_id": "XP_011520831.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 4320,
"cds_start": -4,
"cds_end": null,
"cds_length": 12963,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 14171,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 48,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKD1",
"gene_hgnc_id": 9008,
"hgvs_c": "c.*1170_*1201delCCACCTCATAGCCAGGTGTGGGCTCGGCTGGA",
"hgvs_p": null,
"transcript": "XM_047434210.1",
"protein_id": "XP_047290166.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 4297,
"cds_start": -4,
"cds_end": null,
"cds_length": 12894,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 15171,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 48,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKD1",
"gene_hgnc_id": 9008,
"hgvs_c": "c.*1170_*1201delCCACCTCATAGCCAGGTGTGGGCTCGGCTGGA",
"hgvs_p": null,
"transcript": "XM_047434211.1",
"protein_id": "XP_047290167.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 4278,
"cds_start": -4,
"cds_end": null,
"cds_length": 12837,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 14075,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKD1",
"gene_hgnc_id": 9008,
"hgvs_c": "c.*1170_*1201delCCACCTCATAGCCAGGTGTGGGCTCGGCTGGA",
"hgvs_p": null,
"transcript": "XM_047434212.1",
"protein_id": "XP_047290168.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 3668,
"cds_start": -4,
"cds_end": null,
"cds_length": 11007,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12127,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 36,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKD1",
"gene_hgnc_id": 9008,
"hgvs_c": "c.*1170_*1201delCCACCTCATAGCCAGGTGTGGGCTCGGCTGGA",
"hgvs_p": null,
"transcript": "XM_011522537.2",
"protein_id": "XP_011520839.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 3329,
"cds_start": -4,
"cds_end": null,
"cds_length": 9990,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 11098,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 36,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKD1",
"gene_hgnc_id": 9008,
"hgvs_c": "c.*1170_*1201delCCACCTCATAGCCAGGTGTGGGCTCGGCTGGA",
"hgvs_p": null,
"transcript": "XM_047434213.1",
"protein_id": "XP_047290169.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 3327,
"cds_start": -4,
"cds_end": null,
"cds_length": 9984,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 11092,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 35,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "PKD1",
"gene_hgnc_id": 9008,
"hgvs_c": "c.*1170_*1201delCCACCTCATAGCCAGGTGTGGGCTCGGCTGGA",
"hgvs_p": null,
"transcript": "XM_005255370.4",
"protein_id": "XP_005255427.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 3288,
"cds_start": -4,
"cds_end": null,
"cds_length": 9867,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 11058,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"dbsnp": "rs137854420",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 4.464,
"phylop100way_prediction": "Uncertain_significance",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 4,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "PVS1_Strong",
"acmg_by_gene": [
{
"score": 4,
"benign_score": 0,
"pathogenic_score": 4,
"criteria": [
"PVS1_Strong"
],
"verdict": "Uncertain_significance",
"transcript": "ENST00000219476.9",
"gene_symbol": "TSC2",
"hgnc_id": 12363,
"effects": [
"frameshift_variant"
],
"inheritance_mode": "AD",
"hgvs_c": "c.5340_5371delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG",
"hgvs_p": "p.Pro1784fs"
},
{
"score": 0,
"benign_score": 0,
"pathogenic_score": 0,
"criteria": [],
"verdict": "Uncertain_significance",
"transcript": "ENST00000262304.9",
"gene_symbol": "PKD1",
"hgnc_id": 9008,
"effects": [
"downstream_gene_variant"
],
"inheritance_mode": "AD,AR",
"hgvs_c": "c.*1170_*1201delCCACCTCATAGCCAGGTGTGGGCTCGGCTGGA",
"hgvs_p": null
}
],
"clinvar_disease": "Tuberous sclerosis syndrome",
"clinvar_classification": "not provided",
"clinvar_review_status": "no classification provided",
"clinvar_submissions_summary": "O:1",
"phenotype_combined": "Tuberous sclerosis syndrome",
"pathogenicity_classification_combined": "not provided",
"custom_annotations": null
}
],
"message": null
}