← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 17-43094389-TTCTGAATGCTGCTATTTAGTGTTATCCAAGGAACATCTTCAGTATCTCTAGGATTC-T (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=17&pos=43094389&ref=TTCTGAATGCTGCTATTTAGTGTTATCCAAGGAACATCTTCAGTATCTCTAGGATTC&alt=T&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "17",
"pos": 43094389,
"ref": "TTCTGAATGCTGCTATTTAGTGTTATCCAAGGAACATCTTCAGTATCTCTAGGATTC",
"alt": "T",
"effect": "frameshift_variant",
"transcript": "ENST00000357654.9",
"consequences": [
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_007294.4",
"protein_id": "NP_009225.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1863,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5592,
"cdna_start": 1254,
"cdna_end": null,
"cdna_length": 7088,
"mane_select": "ENST00000357654.9",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "ENST00000357654.9",
"protein_id": "ENSP00000350283.3",
"transcript_support_level": 1,
"aa_start": 362,
"aa_end": null,
"aa_length": 1863,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5592,
"cdna_start": 1254,
"cdna_end": null,
"cdna_length": 7088,
"mane_select": "NM_007294.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "ENST00000471181.7",
"protein_id": "ENSP00000418960.2",
"transcript_support_level": 1,
"aa_start": 362,
"aa_end": null,
"aa_length": 1884,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5655,
"cdna_start": 1373,
"cdna_end": null,
"cdna_length": 7270,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "ENST00000470026.6",
"protein_id": "ENSP00000419274.2",
"transcript_support_level": 1,
"aa_start": 362,
"aa_end": null,
"aa_length": 1863,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5592,
"cdna_start": 1322,
"cdna_end": null,
"cdna_length": 7147,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "ENST00000494123.6",
"protein_id": "ENSP00000419103.2",
"transcript_support_level": 1,
"aa_start": 362,
"aa_end": null,
"aa_length": 1863,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5592,
"cdna_start": 1334,
"cdna_end": null,
"cdna_length": 7168,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "ENST00000618469.2",
"protein_id": "ENSP00000478114.2",
"transcript_support_level": 1,
"aa_start": 362,
"aa_end": null,
"aa_length": 1863,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5592,
"cdna_start": 1788,
"cdna_end": null,
"cdna_length": 7613,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1008_1063delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn337fs",
"transcript": "ENST00000477152.6",
"protein_id": "ENSP00000419988.2",
"transcript_support_level": 1,
"aa_start": 336,
"aa_end": null,
"aa_length": 1837,
"cds_start": 1008,
"cds_end": null,
"cds_length": 5514,
"cdna_start": 1176,
"cdna_end": null,
"cdna_length": 7010,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.198_253delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn67fs",
"transcript": "ENST00000497488.2",
"protein_id": "ENSP00000418986.2",
"transcript_support_level": 1,
"aa_start": 66,
"aa_end": null,
"aa_length": 1567,
"cds_start": 198,
"cds_end": null,
"cds_length": 4704,
"cdna_start": 501,
"cdna_end": null,
"cdna_length": 6335,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "n.1150_1205delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "ENST00000354071.8",
"protein_id": null,
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4497,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "n.*869_*924delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "ENST00000461221.5",
"protein_id": "ENSP00000418548.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5693,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "n.*1022_*1077delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "ENST00000492859.5",
"protein_id": "ENSP00000420253.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1584,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "n.*869_*924delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "ENST00000461221.5",
"protein_id": "ENSP00000418548.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5693,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "n.*1022_*1077delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "ENST00000492859.5",
"protein_id": "ENSP00000420253.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1584,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.784+299_784+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "ENST00000478531.6",
"protein_id": "ENSP00000420412.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 759,
"cds_start": -4,
"cds_end": null,
"cds_length": 2280,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3765,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "ENST00000468300.5",
"protein_id": "ENSP00000417148.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 699,
"cds_start": -4,
"cds_end": null,
"cds_length": 2100,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3273,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.-43-19924_-43-19869delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "ENST00000591534.5",
"protein_id": "ENSP00000467329.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 354,
"cds_start": -4,
"cds_end": null,
"cds_length": 1065,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1282,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.5-30494_5-30439delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "ENST00000586385.5",
"protein_id": "ENSP00000465818.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 173,
"cds_start": -4,
"cds_end": null,
"cds_length": 522,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 781,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.-99+30826_-99+30881delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "ENST00000591849.5",
"protein_id": "ENSP00000465347.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 96,
"cds_start": -4,
"cds_end": null,
"cds_length": 291,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 563,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407581.1",
"protein_id": "NP_001394510.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1885,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5658,
"cdna_start": 1254,
"cdna_end": null,
"cdna_length": 7154,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407582.1",
"protein_id": "NP_001394511.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1885,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5658,
"cdna_start": 1343,
"cdna_end": null,
"cdna_length": 7243,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "ENST00000644379.2",
"protein_id": "ENSP00000496570.2",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1885,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5658,
"cdna_start": 1254,
"cdna_end": null,
"cdna_length": 6363,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407583.1",
"protein_id": "NP_001394512.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1884,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5655,
"cdna_start": 1788,
"cdna_end": null,
"cdna_length": 7685,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407585.1",
"protein_id": "NP_001394514.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1884,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5655,
"cdna_start": 1241,
"cdna_end": null,
"cdna_length": 7138,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407587.1",
"protein_id": "NP_001394516.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1884,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5655,
"cdna_start": 1245,
"cdna_end": null,
"cdna_length": 7145,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_007300.4",
"protein_id": "NP_009231.2",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1884,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5655,
"cdna_start": 1254,
"cdna_end": null,
"cdna_length": 7151,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407590.1",
"protein_id": "NP_001394519.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1883,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5652,
"cdna_start": 1251,
"cdna_end": null,
"cdna_length": 7148,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407591.1",
"protein_id": "NP_001394520.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1883,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5652,
"cdna_start": 1785,
"cdna_end": null,
"cdna_length": 7682,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407593.1",
"protein_id": "NP_001394522.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1863,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5592,
"cdna_start": 2409,
"cdna_end": null,
"cdna_length": 8243,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407594.1",
"protein_id": "NP_001394523.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1863,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5592,
"cdna_start": 1788,
"cdna_end": null,
"cdna_length": 7622,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407596.1",
"protein_id": "NP_001394525.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1863,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5592,
"cdna_start": 1420,
"cdna_end": null,
"cdna_length": 7254,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407597.1",
"protein_id": "NP_001394526.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1863,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5592,
"cdna_start": 1343,
"cdna_end": null,
"cdna_length": 7177,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407598.1",
"protein_id": "NP_001394527.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1863,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5592,
"cdna_start": 1248,
"cdna_end": null,
"cdna_length": 7082,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407602.1",
"protein_id": "NP_001394531.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1863,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5592,
"cdna_start": 1241,
"cdna_end": null,
"cdna_length": 7075,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407603.1",
"protein_id": "NP_001394532.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1863,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5592,
"cdna_start": 1235,
"cdna_end": null,
"cdna_length": 7069,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407605.1",
"protein_id": "NP_001394534.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1863,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5592,
"cdna_start": 1775,
"cdna_end": null,
"cdna_length": 7609,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "ENST00000713676.1",
"protein_id": "ENSP00000518978.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1863,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5592,
"cdna_start": 1214,
"cdna_end": null,
"cdna_length": 7039,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407610.1",
"protein_id": "NP_001394539.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1862,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5589,
"cdna_start": 2406,
"cdna_end": null,
"cdna_length": 8240,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407611.1",
"protein_id": "NP_001394540.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1862,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5589,
"cdna_start": 1251,
"cdna_end": null,
"cdna_length": 7085,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407612.1",
"protein_id": "NP_001394541.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1862,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5589,
"cdna_start": 1340,
"cdna_end": null,
"cdna_length": 7174,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407613.1",
"protein_id": "NP_001394542.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1862,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5589,
"cdna_start": 1232,
"cdna_end": null,
"cdna_length": 7066,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407614.1",
"protein_id": "NP_001394543.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1862,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5589,
"cdna_start": 1245,
"cdna_end": null,
"cdna_length": 7079,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407615.1",
"protein_id": "NP_001394544.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1862,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5589,
"cdna_start": 1785,
"cdna_end": null,
"cdna_length": 7619,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407616.1",
"protein_id": "NP_001394545.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1862,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5589,
"cdna_start": 1254,
"cdna_end": null,
"cdna_length": 7085,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407617.1",
"protein_id": "NP_001394546.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1862,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5589,
"cdna_start": 1248,
"cdna_end": null,
"cdna_length": 7079,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407618.1",
"protein_id": "NP_001394547.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1862,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5589,
"cdna_start": 1235,
"cdna_end": null,
"cdna_length": 7066,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407619.1",
"protein_id": "NP_001394548.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1862,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5589,
"cdna_start": 1788,
"cdna_end": null,
"cdna_length": 7619,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407620.1",
"protein_id": "NP_001394549.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1862,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5589,
"cdna_start": 1343,
"cdna_end": null,
"cdna_length": 7174,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407621.1",
"protein_id": "NP_001394550.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1862,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5589,
"cdna_start": 2409,
"cdna_end": null,
"cdna_length": 8240,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407622.1",
"protein_id": "NP_001394551.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1862,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5589,
"cdna_start": 1241,
"cdna_end": null,
"cdna_length": 7072,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407623.1",
"protein_id": "NP_001394552.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1862,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5589,
"cdna_start": 1775,
"cdna_end": null,
"cdna_length": 7606,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407624.1",
"protein_id": "NP_001394553.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1862,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5589,
"cdna_start": 1254,
"cdna_end": null,
"cdna_length": 7085,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407625.1",
"protein_id": "NP_001394554.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1862,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5589,
"cdna_start": 1788,
"cdna_end": null,
"cdna_length": 7619,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407626.1",
"protein_id": "NP_001394555.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1862,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5589,
"cdna_start": 1248,
"cdna_end": null,
"cdna_length": 7079,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "ENST00000461574.2",
"protein_id": "ENSP00000417241.2",
"transcript_support_level": 2,
"aa_start": 362,
"aa_end": null,
"aa_length": 1862,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5589,
"cdna_start": 1260,
"cdna_end": null,
"cdna_length": 7082,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407627.1",
"protein_id": "NP_001394556.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1861,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5586,
"cdna_start": 1245,
"cdna_end": null,
"cdna_length": 7076,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407628.1",
"protein_id": "NP_001394557.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1861,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5586,
"cdna_start": 1251,
"cdna_end": null,
"cdna_length": 7082,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407629.1",
"protein_id": "NP_001394558.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1861,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5586,
"cdna_start": 1340,
"cdna_end": null,
"cdna_length": 7171,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407630.1",
"protein_id": "NP_001394559.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1861,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5586,
"cdna_start": 1785,
"cdna_end": null,
"cdna_length": 7616,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407631.1",
"protein_id": "NP_001394560.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1861,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5586,
"cdna_start": 1238,
"cdna_end": null,
"cdna_length": 7069,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407632.1",
"protein_id": "NP_001394561.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1861,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5586,
"cdna_start": 1232,
"cdna_end": null,
"cdna_length": 7063,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407633.1",
"protein_id": "NP_001394562.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1861,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5586,
"cdna_start": 1785,
"cdna_end": null,
"cdna_length": 7616,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407634.1",
"protein_id": "NP_001394563.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1861,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5586,
"cdna_start": 2406,
"cdna_end": null,
"cdna_length": 8237,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407635.1",
"protein_id": "NP_001394564.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1861,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5586,
"cdna_start": 1245,
"cdna_end": null,
"cdna_length": 7076,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407636.1",
"protein_id": "NP_001394565.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1861,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5586,
"cdna_start": 1340,
"cdna_end": null,
"cdna_length": 7171,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407637.1",
"protein_id": "NP_001394566.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1861,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5586,
"cdna_start": 1251,
"cdna_end": null,
"cdna_length": 7082,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407638.1",
"protein_id": "NP_001394567.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1861,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5586,
"cdna_start": 1238,
"cdna_end": null,
"cdna_length": 7069,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407639.1",
"protein_id": "NP_001394568.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1861,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5586,
"cdna_start": 1343,
"cdna_end": null,
"cdna_length": 7171,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407640.1",
"protein_id": "NP_001394569.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1861,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5586,
"cdna_start": 1248,
"cdna_end": null,
"cdna_length": 7076,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407641.1",
"protein_id": "NP_001394570.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1861,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5586,
"cdna_start": 1254,
"cdna_end": null,
"cdna_length": 7082,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407642.1",
"protein_id": "NP_001394571.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1861,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5586,
"cdna_start": 1788,
"cdna_end": null,
"cdna_length": 7616,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "ENST00000476777.6",
"protein_id": "ENSP00000417554.2",
"transcript_support_level": 5,
"aa_start": 361,
"aa_end": null,
"aa_length": 1861,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5586,
"cdna_start": 1247,
"cdna_end": null,
"cdna_length": 7075,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407644.1",
"protein_id": "NP_001394573.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1860,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5583,
"cdna_start": 1245,
"cdna_end": null,
"cdna_length": 7073,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407645.1",
"protein_id": "NP_001394574.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1860,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5583,
"cdna_start": 1251,
"cdna_end": null,
"cdna_length": 7079,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1077_1132delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn360fs",
"transcript": "NM_001407646.1",
"protein_id": "NP_001394575.1",
"transcript_support_level": null,
"aa_start": 359,
"aa_end": null,
"aa_length": 1859,
"cds_start": 1077,
"cds_end": null,
"cds_length": 5580,
"cdna_start": 1245,
"cdna_end": null,
"cdna_length": 7076,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1077_1132delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn360fs",
"transcript": "NM_001407647.1",
"protein_id": "NP_001394576.1",
"transcript_support_level": null,
"aa_start": 359,
"aa_end": null,
"aa_length": 1858,
"cds_start": 1077,
"cds_end": null,
"cds_length": 5577,
"cdna_start": 1239,
"cdna_end": null,
"cdna_length": 7067,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407648.1",
"protein_id": "NP_001394577.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1844,
"cds_start": 963,
"cds_end": null,
"cds_length": 5535,
"cdna_start": 1131,
"cdna_end": null,
"cdna_length": 7031,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.960_1015delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn321fs",
"transcript": "NM_001407649.1",
"protein_id": "NP_001394578.1",
"transcript_support_level": null,
"aa_start": 320,
"aa_end": null,
"aa_length": 1843,
"cds_start": 960,
"cds_end": null,
"cds_length": 5532,
"cdna_start": 1122,
"cdna_end": null,
"cdna_length": 7022,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407652.1",
"protein_id": "NP_001394581.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1837,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5514,
"cdna_start": 1248,
"cdna_end": null,
"cdna_length": 7004,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1008_1063delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn337fs",
"transcript": "NM_001407653.1",
"protein_id": "NP_001394582.1",
"transcript_support_level": null,
"aa_start": 336,
"aa_end": null,
"aa_length": 1837,
"cds_start": 1008,
"cds_end": null,
"cds_length": 5514,
"cdna_start": 1176,
"cdna_end": null,
"cdna_length": 7010,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1008_1063delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn337fs",
"transcript": "NM_001407654.1",
"protein_id": "NP_001394583.1",
"transcript_support_level": null,
"aa_start": 336,
"aa_end": null,
"aa_length": 1837,
"cds_start": 1008,
"cds_end": null,
"cds_length": 5514,
"cdna_start": 1170,
"cdna_end": null,
"cdna_length": 7004,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1008_1063delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn337fs",
"transcript": "NM_001407655.1",
"protein_id": "NP_001394584.1",
"transcript_support_level": null,
"aa_start": 336,
"aa_end": null,
"aa_length": 1837,
"cds_start": 1008,
"cds_end": null,
"cds_length": 5514,
"cdna_start": 1710,
"cdna_end": null,
"cdna_length": 7544,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1008_1063delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn337fs",
"transcript": "ENST00000489037.2",
"protein_id": "ENSP00000420781.2",
"transcript_support_level": 4,
"aa_start": 336,
"aa_end": null,
"aa_length": 1837,
"cds_start": 1008,
"cds_end": null,
"cds_length": 5514,
"cdna_start": 1222,
"cdna_end": null,
"cdna_length": 7056,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1008_1063delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn337fs",
"transcript": "NM_001407656.1",
"protein_id": "NP_001394585.1",
"transcript_support_level": null,
"aa_start": 336,
"aa_end": null,
"aa_length": 1836,
"cds_start": 1008,
"cds_end": null,
"cds_length": 5511,
"cdna_start": 1170,
"cdna_end": null,
"cdna_length": 7001,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1008_1063delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn337fs",
"transcript": "NM_001407657.1",
"protein_id": "NP_001394586.1",
"transcript_support_level": null,
"aa_start": 336,
"aa_end": null,
"aa_length": 1836,
"cds_start": 1008,
"cds_end": null,
"cds_length": 5511,
"cdna_start": 1170,
"cdna_end": null,
"cdna_length": 7001,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1008_1063delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn337fs",
"transcript": "NM_001407658.1",
"protein_id": "NP_001394587.1",
"transcript_support_level": null,
"aa_start": 336,
"aa_end": null,
"aa_length": 1836,
"cds_start": 1008,
"cds_end": null,
"cds_length": 5511,
"cdna_start": 1176,
"cdna_end": null,
"cdna_length": 7007,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1005_1060delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn336fs",
"transcript": "NM_001407659.1",
"protein_id": "NP_001394588.1",
"transcript_support_level": null,
"aa_start": 335,
"aa_end": null,
"aa_length": 1835,
"cds_start": 1005,
"cds_end": null,
"cds_length": 5508,
"cdna_start": 1167,
"cdna_end": null,
"cdna_length": 6998,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1005_1060delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn336fs",
"transcript": "NM_001407660.1",
"protein_id": "NP_001394589.1",
"transcript_support_level": null,
"aa_start": 335,
"aa_end": null,
"aa_length": 1835,
"cds_start": 1005,
"cds_end": null,
"cds_length": 5508,
"cdna_start": 1173,
"cdna_end": null,
"cdna_length": 7004,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1005_1060delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn336fs",
"transcript": "NM_001407661.1",
"protein_id": "NP_001394590.1",
"transcript_support_level": null,
"aa_start": 335,
"aa_end": null,
"aa_length": 1835,
"cds_start": 1005,
"cds_end": null,
"cds_length": 5508,
"cdna_start": 1173,
"cdna_end": null,
"cdna_length": 7004,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1005_1060delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn336fs",
"transcript": "NM_001407662.1",
"protein_id": "NP_001394591.1",
"transcript_support_level": null,
"aa_start": 335,
"aa_end": null,
"aa_length": 1835,
"cds_start": 1005,
"cds_end": null,
"cds_length": 5508,
"cdna_start": 1167,
"cdna_end": null,
"cdna_length": 6998,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1008_1063delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn337fs",
"transcript": "NM_001407663.1",
"protein_id": "NP_001394592.1",
"transcript_support_level": null,
"aa_start": 336,
"aa_end": null,
"aa_length": 1835,
"cds_start": 1008,
"cds_end": null,
"cds_length": 5508,
"cdna_start": 1176,
"cdna_end": null,
"cdna_length": 7004,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407664.1",
"protein_id": "NP_001394593.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1822,
"cds_start": 963,
"cds_end": null,
"cds_length": 5469,
"cdna_start": 1131,
"cdna_end": null,
"cdna_length": 6965,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407665.1",
"protein_id": "NP_001394594.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1822,
"cds_start": 963,
"cds_end": null,
"cds_length": 5469,
"cdna_start": 1112,
"cdna_end": null,
"cdna_length": 6946,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407666.1",
"protein_id": "NP_001394595.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1822,
"cds_start": 963,
"cds_end": null,
"cds_length": 5469,
"cdna_start": 1220,
"cdna_end": null,
"cdna_length": 7054,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407667.1",
"protein_id": "NP_001394596.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1822,
"cds_start": 963,
"cds_end": null,
"cds_length": 5469,
"cdna_start": 1125,
"cdna_end": null,
"cdna_length": 6959,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407668.1",
"protein_id": "NP_001394597.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1822,
"cds_start": 963,
"cds_end": null,
"cds_length": 5469,
"cdna_start": 1118,
"cdna_end": null,
"cdna_length": 6952,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407669.1",
"protein_id": "NP_001394598.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1822,
"cds_start": 963,
"cds_end": null,
"cds_length": 5469,
"cdna_start": 1665,
"cdna_end": null,
"cdna_length": 7499,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "ENST00000634433.2",
"protein_id": "ENSP00000489431.2",
"transcript_support_level": 5,
"aa_start": 321,
"aa_end": null,
"aa_length": 1822,
"cds_start": 963,
"cds_end": null,
"cds_length": 5469,
"cdna_start": 1157,
"cdna_end": null,
"cdna_length": 6991,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.960_1015delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn321fs",
"transcript": "NM_001407670.1",
"protein_id": "NP_001394599.1",
"transcript_support_level": null,
"aa_start": 320,
"aa_end": null,
"aa_length": 1821,
"cds_start": 960,
"cds_end": null,
"cds_length": 5466,
"cdna_start": 1128,
"cdna_end": null,
"cdna_length": 6962,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.960_1015delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn321fs",
"transcript": "NM_001407671.1",
"protein_id": "NP_001394600.1",
"transcript_support_level": null,
"aa_start": 320,
"aa_end": null,
"aa_length": 1821,
"cds_start": 960,
"cds_end": null,
"cds_length": 5466,
"cdna_start": 1122,
"cdna_end": null,
"cdna_length": 6956,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.960_1015delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn321fs",
"transcript": "NM_001407672.1",
"protein_id": "NP_001394601.1",
"transcript_support_level": null,
"aa_start": 320,
"aa_end": null,
"aa_length": 1821,
"cds_start": 960,
"cds_end": null,
"cds_length": 5466,
"cdna_start": 1217,
"cdna_end": null,
"cdna_length": 7051,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.960_1015delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn321fs",
"transcript": "NM_001407673.1",
"protein_id": "NP_001394602.1",
"transcript_support_level": null,
"aa_start": 320,
"aa_end": null,
"aa_length": 1821,
"cds_start": 960,
"cds_end": null,
"cds_length": 5466,
"cdna_start": 1662,
"cdna_end": null,
"cdna_length": 7496,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407674.1",
"protein_id": "NP_001394603.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1821,
"cds_start": 963,
"cds_end": null,
"cds_length": 5466,
"cdna_start": 1665,
"cdna_end": null,
"cdna_length": 7496,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407675.1",
"protein_id": "NP_001394604.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1821,
"cds_start": 963,
"cds_end": null,
"cds_length": 5466,
"cdna_start": 1131,
"cdna_end": null,
"cdna_length": 6962,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407676.1",
"protein_id": "NP_001394605.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1821,
"cds_start": 963,
"cds_end": null,
"cds_length": 5466,
"cdna_start": 1125,
"cdna_end": null,
"cdna_length": 6956,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407677.1",
"protein_id": "NP_001394606.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1821,
"cds_start": 963,
"cds_end": null,
"cds_length": 5466,
"cdna_start": 1665,
"cdna_end": null,
"cdna_length": 7496,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407678.1",
"protein_id": "NP_001394607.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1821,
"cds_start": 963,
"cds_end": null,
"cds_length": 5466,
"cdna_start": 1220,
"cdna_end": null,
"cdna_length": 7051,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407679.1",
"protein_id": "NP_001394608.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1821,
"cds_start": 963,
"cds_end": null,
"cds_length": 5466,
"cdna_start": 1125,
"cdna_end": null,
"cdna_length": 6956,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407680.1",
"protein_id": "NP_001394609.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1821,
"cds_start": 963,
"cds_end": null,
"cds_length": 5466,
"cdna_start": 1131,
"cdna_end": null,
"cdna_length": 6962,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.960_1015delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn321fs",
"transcript": "ENST00000473961.6",
"protein_id": "ENSP00000420201.2",
"transcript_support_level": 2,
"aa_start": 320,
"aa_end": null,
"aa_length": 1821,
"cds_start": 960,
"cds_end": null,
"cds_length": 5466,
"cdna_start": 1128,
"cdna_end": null,
"cdna_length": 6962,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407681.1",
"protein_id": "NP_001394610.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1820,
"cds_start": 963,
"cds_end": null,
"cds_length": 5463,
"cdna_start": 1131,
"cdna_end": null,
"cdna_length": 6959,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407682.1",
"protein_id": "NP_001394611.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1820,
"cds_start": 963,
"cds_end": null,
"cds_length": 5463,
"cdna_start": 1125,
"cdna_end": null,
"cdna_length": 6953,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407683.1",
"protein_id": "NP_001394612.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1820,
"cds_start": 963,
"cds_end": null,
"cds_length": 5463,
"cdna_start": 1665,
"cdna_end": null,
"cdna_length": 7493,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407684.1",
"protein_id": "NP_001394613.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1820,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5463,
"cdna_start": 1788,
"cdna_end": null,
"cdna_length": 7493,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.960_1015delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn321fs",
"transcript": "NM_001407685.1",
"protein_id": "NP_001394614.1",
"transcript_support_level": null,
"aa_start": 320,
"aa_end": null,
"aa_length": 1820,
"cds_start": 960,
"cds_end": null,
"cds_length": 5463,
"cdna_start": 1122,
"cdna_end": null,
"cdna_length": 6953,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.960_1015delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn321fs",
"transcript": "NM_001407686.1",
"protein_id": "NP_001394615.1",
"transcript_support_level": null,
"aa_start": 320,
"aa_end": null,
"aa_length": 1820,
"cds_start": 960,
"cds_end": null,
"cds_length": 5463,
"cdna_start": 1109,
"cdna_end": null,
"cdna_length": 6940,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.960_1015delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn321fs",
"transcript": "NM_001407687.1",
"protein_id": "NP_001394616.1",
"transcript_support_level": null,
"aa_start": 320,
"aa_end": null,
"aa_length": 1820,
"cds_start": 960,
"cds_end": null,
"cds_length": 5463,
"cdna_start": 1662,
"cdna_end": null,
"cdna_length": 7493,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.960_1015delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn321fs",
"transcript": "NM_001407688.1",
"protein_id": "NP_001394617.1",
"transcript_support_level": null,
"aa_start": 320,
"aa_end": null,
"aa_length": 1820,
"cds_start": 960,
"cds_end": null,
"cds_length": 5463,
"cdna_start": 1122,
"cdna_end": null,
"cdna_length": 6953,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.960_1015delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn321fs",
"transcript": "NM_001407689.1",
"protein_id": "NP_001394618.1",
"transcript_support_level": null,
"aa_start": 320,
"aa_end": null,
"aa_length": 1820,
"cds_start": 960,
"cds_end": null,
"cds_length": 5463,
"cdna_start": 1128,
"cdna_end": null,
"cdna_length": 6959,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.960_1015delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn321fs",
"transcript": "NM_001407690.1",
"protein_id": "NP_001394619.1",
"transcript_support_level": null,
"aa_start": 320,
"aa_end": null,
"aa_length": 1819,
"cds_start": 960,
"cds_end": null,
"cds_length": 5460,
"cdna_start": 1662,
"cdna_end": null,
"cdna_length": 7490,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.960_1015delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn321fs",
"transcript": "NM_001407691.1",
"protein_id": "NP_001394620.1",
"transcript_support_level": null,
"aa_start": 320,
"aa_end": null,
"aa_length": 1819,
"cds_start": 960,
"cds_end": null,
"cds_length": 5460,
"cdna_start": 1122,
"cdna_end": null,
"cdna_length": 6950,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407692.1",
"protein_id": "NP_001394621.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1816,
"cds_start": 945,
"cds_end": null,
"cds_length": 5451,
"cdna_start": 1101,
"cdna_end": null,
"cdna_length": 6935,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407694.1",
"protein_id": "NP_001394623.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1816,
"cds_start": 945,
"cds_end": null,
"cds_length": 5451,
"cdna_start": 1370,
"cdna_end": null,
"cdna_length": 7204,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407695.1",
"protein_id": "NP_001394624.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1816,
"cds_start": 945,
"cds_end": null,
"cds_length": 5451,
"cdna_start": 1368,
"cdna_end": null,
"cdna_length": 7202,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 25,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407696.1",
"protein_id": "NP_001394625.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1816,
"cds_start": 945,
"cds_end": null,
"cds_length": 5451,
"cdna_start": 1515,
"cdna_end": null,
"cdna_length": 7349,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407697.1",
"protein_id": "NP_001394626.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1816,
"cds_start": 945,
"cds_end": null,
"cds_length": 5451,
"cdna_start": 1933,
"cdna_end": null,
"cdna_length": 7767,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407698.1",
"protein_id": "NP_001394627.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1816,
"cds_start": 945,
"cds_end": null,
"cds_length": 5451,
"cdna_start": 1200,
"cdna_end": null,
"cdna_length": 7034,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407724.1",
"protein_id": "NP_001394653.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1816,
"cds_start": 945,
"cds_end": null,
"cds_length": 5451,
"cdna_start": 1904,
"cdna_end": null,
"cdna_length": 7738,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407725.1",
"protein_id": "NP_001394654.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1816,
"cds_start": 945,
"cds_end": null,
"cds_length": 5451,
"cdna_start": 1373,
"cdna_end": null,
"cdna_length": 7207,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407726.1",
"protein_id": "NP_001394655.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1816,
"cds_start": 945,
"cds_end": null,
"cds_length": 5451,
"cdna_start": 1313,
"cdna_end": null,
"cdna_length": 7147,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 25,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407727.1",
"protein_id": "NP_001394656.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1816,
"cds_start": 945,
"cds_end": null,
"cds_length": 5451,
"cdna_start": 1542,
"cdna_end": null,
"cdna_length": 7376,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407728.1",
"protein_id": "NP_001394657.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1816,
"cds_start": 945,
"cds_end": null,
"cds_length": 5451,
"cdna_start": 1149,
"cdna_end": null,
"cdna_length": 6983,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407729.1",
"protein_id": "NP_001394658.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1816,
"cds_start": 945,
"cds_end": null,
"cds_length": 5451,
"cdna_start": 1155,
"cdna_end": null,
"cdna_length": 6989,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407730.1",
"protein_id": "NP_001394659.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1816,
"cds_start": 945,
"cds_end": null,
"cds_length": 5451,
"cdna_start": 1367,
"cdna_end": null,
"cdna_length": 7201,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407731.1",
"protein_id": "NP_001394660.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1816,
"cds_start": 945,
"cds_end": null,
"cds_length": 5451,
"cdna_start": 1364,
"cdna_end": null,
"cdna_length": 7198,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_007297.4",
"protein_id": "NP_009228.2",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1816,
"cds_start": 945,
"cds_end": null,
"cds_length": 5451,
"cdna_start": 1194,
"cdna_end": null,
"cdna_length": 7028,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "ENST00000493795.5",
"protein_id": "ENSP00000418775.1",
"transcript_support_level": 5,
"aa_start": 315,
"aa_end": null,
"aa_length": 1816,
"cds_start": 945,
"cds_end": null,
"cds_length": 5451,
"cdna_start": 1232,
"cdna_end": null,
"cdna_length": 5732,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "ENST00000652672.2",
"protein_id": "ENSP00000498906.2",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1816,
"cds_start": 945,
"cds_end": null,
"cds_length": 5451,
"cdna_start": 1486,
"cdna_end": null,
"cdna_length": 7320,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407732.1",
"protein_id": "NP_001394661.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1815,
"cds_start": 945,
"cds_end": null,
"cds_length": 5448,
"cdna_start": 1200,
"cdna_end": null,
"cdna_length": 7031,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407733.1",
"protein_id": "NP_001394662.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1815,
"cds_start": 945,
"cds_end": null,
"cds_length": 5448,
"cdna_start": 1370,
"cdna_end": null,
"cdna_length": 7201,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407734.1",
"protein_id": "NP_001394663.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1815,
"cds_start": 945,
"cds_end": null,
"cds_length": 5448,
"cdna_start": 1367,
"cdna_end": null,
"cdna_length": 7198,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407735.1",
"protein_id": "NP_001394664.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1815,
"cds_start": 945,
"cds_end": null,
"cds_length": 5448,
"cdna_start": 1155,
"cdna_end": null,
"cdna_length": 6986,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407736.1",
"protein_id": "NP_001394665.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1815,
"cds_start": 945,
"cds_end": null,
"cds_length": 5448,
"cdna_start": 1194,
"cdna_end": null,
"cdna_length": 7025,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407737.1",
"protein_id": "NP_001394666.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1815,
"cds_start": 945,
"cds_end": null,
"cds_length": 5448,
"cdna_start": 1149,
"cdna_end": null,
"cdna_length": 6980,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407738.1",
"protein_id": "NP_001394667.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1815,
"cds_start": 945,
"cds_end": null,
"cds_length": 5448,
"cdna_start": 1181,
"cdna_end": null,
"cdna_length": 7012,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407739.1",
"protein_id": "NP_001394668.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1815,
"cds_start": 945,
"cds_end": null,
"cds_length": 5448,
"cdna_start": 1373,
"cdna_end": null,
"cdna_length": 7204,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407740.1",
"protein_id": "NP_001394669.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1815,
"cds_start": 942,
"cds_end": null,
"cds_length": 5448,
"cdna_start": 1370,
"cdna_end": null,
"cdna_length": 7204,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407741.1",
"protein_id": "NP_001394670.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1815,
"cds_start": 942,
"cds_end": null,
"cds_length": 5448,
"cdna_start": 1908,
"cdna_end": null,
"cdna_length": 7742,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407742.1",
"protein_id": "NP_001394671.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1815,
"cds_start": 942,
"cds_end": null,
"cds_length": 5448,
"cdna_start": 1191,
"cdna_end": null,
"cdna_length": 7025,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407743.1",
"protein_id": "NP_001394672.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1815,
"cds_start": 942,
"cds_end": null,
"cds_length": 5448,
"cdna_start": 1152,
"cdna_end": null,
"cdna_length": 6986,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407744.1",
"protein_id": "NP_001394673.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1815,
"cds_start": 942,
"cds_end": null,
"cds_length": 5448,
"cdna_start": 1197,
"cdna_end": null,
"cdna_length": 7031,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407745.1",
"protein_id": "NP_001394674.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1815,
"cds_start": 942,
"cds_end": null,
"cds_length": 5448,
"cdna_start": 1146,
"cdna_end": null,
"cdna_length": 6980,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407746.1",
"protein_id": "NP_001394675.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1815,
"cds_start": 942,
"cds_end": null,
"cds_length": 5448,
"cdna_start": 1262,
"cdna_end": null,
"cdna_length": 7096,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407747.1",
"protein_id": "NP_001394676.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1815,
"cds_start": 942,
"cds_end": null,
"cds_length": 5448,
"cdna_start": 1092,
"cdna_end": null,
"cdna_length": 6926,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407748.1",
"protein_id": "NP_001394677.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1815,
"cds_start": 942,
"cds_end": null,
"cds_length": 5448,
"cdna_start": 1364,
"cdna_end": null,
"cdna_length": 7198,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407749.1",
"protein_id": "NP_001394678.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1815,
"cds_start": 942,
"cds_end": null,
"cds_length": 5448,
"cdna_start": 1361,
"cdna_end": null,
"cdna_length": 7195,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407750.1",
"protein_id": "NP_001394679.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1815,
"cds_start": 945,
"cds_end": null,
"cds_length": 5448,
"cdna_start": 1200,
"cdna_end": null,
"cdna_length": 7031,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407751.1",
"protein_id": "NP_001394680.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1815,
"cds_start": 945,
"cds_end": null,
"cds_length": 5448,
"cdna_start": 1319,
"cdna_end": null,
"cdna_length": 7150,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407752.1",
"protein_id": "NP_001394681.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1815,
"cds_start": 945,
"cds_end": null,
"cds_length": 5448,
"cdna_start": 1367,
"cdna_end": null,
"cdna_length": 7198,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407838.1",
"protein_id": "NP_001394767.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1814,
"cds_start": 942,
"cds_end": null,
"cds_length": 5445,
"cdna_start": 1904,
"cdna_end": null,
"cdna_length": 7735,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407839.1",
"protein_id": "NP_001394768.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1814,
"cds_start": 942,
"cds_end": null,
"cds_length": 5445,
"cdna_start": 1146,
"cdna_end": null,
"cdna_length": 6977,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407841.1",
"protein_id": "NP_001394770.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1814,
"cds_start": 942,
"cds_end": null,
"cds_length": 5445,
"cdna_start": 1336,
"cdna_end": null,
"cdna_length": 7167,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407842.1",
"protein_id": "NP_001394771.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1814,
"cds_start": 942,
"cds_end": null,
"cds_length": 5445,
"cdna_start": 1361,
"cdna_end": null,
"cdna_length": 7192,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407843.1",
"protein_id": "NP_001394772.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1814,
"cds_start": 942,
"cds_end": null,
"cds_length": 5445,
"cdna_start": 1367,
"cdna_end": null,
"cdna_length": 7198,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407844.1",
"protein_id": "NP_001394773.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1814,
"cds_start": 942,
"cds_end": null,
"cds_length": 5445,
"cdna_start": 1152,
"cdna_end": null,
"cdna_length": 6983,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407845.1",
"protein_id": "NP_001394774.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1814,
"cds_start": 942,
"cds_end": null,
"cds_length": 5445,
"cdna_start": 1197,
"cdna_end": null,
"cdna_length": 7028,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407846.1",
"protein_id": "NP_001394775.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1814,
"cds_start": 942,
"cds_end": null,
"cds_length": 5445,
"cdna_start": 1390,
"cdna_end": null,
"cdna_length": 7221,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407847.1",
"protein_id": "NP_001394776.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1814,
"cds_start": 942,
"cds_end": null,
"cds_length": 5445,
"cdna_start": 1370,
"cdna_end": null,
"cdna_length": 7201,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407848.1",
"protein_id": "NP_001394777.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1814,
"cds_start": 942,
"cds_end": null,
"cds_length": 5445,
"cdna_start": 1146,
"cdna_end": null,
"cdna_length": 6977,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407849.1",
"protein_id": "NP_001394778.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1814,
"cds_start": 942,
"cds_end": null,
"cds_length": 5445,
"cdna_start": 1197,
"cdna_end": null,
"cdna_length": 7028,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407850.1",
"protein_id": "NP_001394779.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1814,
"cds_start": 945,
"cds_end": null,
"cds_length": 5445,
"cdna_start": 1367,
"cdna_end": null,
"cdna_length": 7195,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407851.1",
"protein_id": "NP_001394780.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1814,
"cds_start": 945,
"cds_end": null,
"cds_length": 5445,
"cdna_start": 1155,
"cdna_end": null,
"cdna_length": 6983,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407852.1",
"protein_id": "NP_001394781.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1814,
"cds_start": 945,
"cds_end": null,
"cds_length": 5445,
"cdna_start": 1200,
"cdna_end": null,
"cdna_length": 7028,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.873_928delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn292fs",
"transcript": "NM_001407853.1",
"protein_id": "NP_001394782.1",
"transcript_support_level": null,
"aa_start": 291,
"aa_end": null,
"aa_length": 1814,
"cds_start": 873,
"cds_end": null,
"cds_length": 5445,
"cdna_start": 1229,
"cdna_end": null,
"cdna_length": 7129,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407854.1",
"protein_id": "NP_001394783.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1803,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5412,
"cdna_start": 1248,
"cdna_end": null,
"cdna_length": 7008,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407858.1",
"protein_id": "NP_001394787.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1802,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5409,
"cdna_start": 1254,
"cdna_end": null,
"cdna_length": 7011,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs",
"transcript": "NM_001407859.1",
"protein_id": "NP_001394788.1",
"transcript_support_level": null,
"aa_start": 362,
"aa_end": null,
"aa_length": 1802,
"cds_start": 1086,
"cds_end": null,
"cds_length": 5409,
"cdna_start": 1343,
"cdna_end": null,
"cdna_length": 7100,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407860.1",
"protein_id": "NP_001394789.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1802,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5409,
"cdna_start": 1251,
"cdna_end": null,
"cdna_length": 7011,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.1083_1138delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn362fs",
"transcript": "NM_001407861.1",
"protein_id": "NP_001394790.1",
"transcript_support_level": null,
"aa_start": 361,
"aa_end": null,
"aa_length": 1801,
"cds_start": 1083,
"cds_end": null,
"cds_length": 5406,
"cdna_start": 1245,
"cdna_end": null,
"cdna_length": 7002,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.885_940delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn296fs",
"transcript": "NM_001407862.1",
"protein_id": "NP_001394791.1",
"transcript_support_level": null,
"aa_start": 295,
"aa_end": null,
"aa_length": 1796,
"cds_start": 885,
"cds_end": null,
"cds_length": 5391,
"cdna_start": 1053,
"cdna_end": null,
"cdna_length": 6887,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407863.1",
"protein_id": "NP_001394792.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1795,
"cds_start": 963,
"cds_end": null,
"cds_length": 5388,
"cdna_start": 1125,
"cdna_end": null,
"cdna_length": 6878,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.882_937delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn295fs",
"transcript": "NM_001407874.1",
"protein_id": "NP_001394803.1",
"transcript_support_level": null,
"aa_start": 294,
"aa_end": null,
"aa_length": 1794,
"cds_start": 882,
"cds_end": null,
"cds_length": 5385,
"cdna_start": 1139,
"cdna_end": null,
"cdna_length": 6970,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.882_937delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn295fs",
"transcript": "NM_001407875.1",
"protein_id": "NP_001394804.1",
"transcript_support_level": null,
"aa_start": 294,
"aa_end": null,
"aa_length": 1794,
"cds_start": 882,
"cds_end": null,
"cds_length": 5385,
"cdna_start": 1044,
"cdna_end": null,
"cdna_length": 6875,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.876_931delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn293fs",
"transcript": "NM_001407879.1",
"protein_id": "NP_001394808.1",
"transcript_support_level": null,
"aa_start": 292,
"aa_end": null,
"aa_length": 1793,
"cds_start": 876,
"cds_end": null,
"cds_length": 5382,
"cdna_start": 1321,
"cdna_end": null,
"cdna_length": 7155,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.876_931delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn293fs",
"transcript": "NM_001407881.1",
"protein_id": "NP_001394810.1",
"transcript_support_level": null,
"aa_start": 292,
"aa_end": null,
"aa_length": 1793,
"cds_start": 876,
"cds_end": null,
"cds_length": 5382,
"cdna_start": 1172,
"cdna_end": null,
"cdna_length": 7006,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.876_931delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn293fs",
"transcript": "NM_001407882.1",
"protein_id": "NP_001394811.1",
"transcript_support_level": null,
"aa_start": 292,
"aa_end": null,
"aa_length": 1793,
"cds_start": 876,
"cds_end": null,
"cds_length": 5382,
"cdna_start": 1766,
"cdna_end": null,
"cdna_length": 7600,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.876_931delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn293fs",
"transcript": "NM_001407884.1",
"protein_id": "NP_001394813.1",
"transcript_support_level": null,
"aa_start": 292,
"aa_end": null,
"aa_length": 1793,
"cds_start": 876,
"cds_end": null,
"cds_length": 5382,
"cdna_start": 1232,
"cdna_end": null,
"cdna_length": 7066,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.876_931delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn293fs",
"transcript": "NM_001407885.1",
"protein_id": "NP_001394814.1",
"transcript_support_level": null,
"aa_start": 292,
"aa_end": null,
"aa_length": 1793,
"cds_start": 876,
"cds_end": null,
"cds_length": 5382,
"cdna_start": 1127,
"cdna_end": null,
"cdna_length": 6961,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.876_931delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn293fs",
"transcript": "NM_001407886.1",
"protein_id": "NP_001394815.1",
"transcript_support_level": null,
"aa_start": 292,
"aa_end": null,
"aa_length": 1793,
"cds_start": 876,
"cds_end": null,
"cds_length": 5382,
"cdna_start": 1213,
"cdna_end": null,
"cdna_length": 7047,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.876_931delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn293fs",
"transcript": "NM_001407887.1",
"protein_id": "NP_001394816.1",
"transcript_support_level": null,
"aa_start": 292,
"aa_end": null,
"aa_length": 1793,
"cds_start": 876,
"cds_end": null,
"cds_length": 5382,
"cdna_start": 1226,
"cdna_end": null,
"cdna_length": 7060,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.876_931delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn293fs",
"transcript": "NM_001407889.1",
"protein_id": "NP_001394818.1",
"transcript_support_level": null,
"aa_start": 292,
"aa_end": null,
"aa_length": 1793,
"cds_start": 876,
"cds_end": null,
"cds_length": 5382,
"cdna_start": 1342,
"cdna_end": null,
"cdna_length": 7176,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.873_928delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn292fs",
"transcript": "NM_001407571.1",
"protein_id": "NP_001394500.1",
"transcript_support_level": null,
"aa_start": 291,
"aa_end": null,
"aa_length": 1792,
"cds_start": 873,
"cds_end": null,
"cds_length": 5379,
"cdna_start": 1318,
"cdna_end": null,
"cdna_length": 7152,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.873_928delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn292fs",
"transcript": "NM_001407894.1",
"protein_id": "NP_001394823.1",
"transcript_support_level": null,
"aa_start": 291,
"aa_end": null,
"aa_length": 1792,
"cds_start": 873,
"cds_end": null,
"cds_length": 5379,
"cdna_start": 1223,
"cdna_end": null,
"cdna_length": 7057,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.873_928delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn292fs",
"transcript": "NM_001407895.1",
"protein_id": "NP_001394824.1",
"transcript_support_level": null,
"aa_start": 291,
"aa_end": null,
"aa_length": 1792,
"cds_start": 873,
"cds_end": null,
"cds_length": 5379,
"cdna_start": 1229,
"cdna_end": null,
"cdna_length": 7063,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.873_928delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn292fs",
"transcript": "NM_001407896.1",
"protein_id": "NP_001394825.1",
"transcript_support_level": null,
"aa_start": 291,
"aa_end": null,
"aa_length": 1792,
"cds_start": 873,
"cds_end": null,
"cds_length": 5379,
"cdna_start": 1219,
"cdna_end": null,
"cdna_length": 7053,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.873_928delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn292fs",
"transcript": "NM_001407897.1",
"protein_id": "NP_001394826.1",
"transcript_support_level": null,
"aa_start": 291,
"aa_end": null,
"aa_length": 1792,
"cds_start": 873,
"cds_end": null,
"cds_length": 5379,
"cdna_start": 1763,
"cdna_end": null,
"cdna_length": 7597,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.873_928delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn292fs",
"transcript": "NM_001407898.1",
"protein_id": "NP_001394827.1",
"transcript_support_level": null,
"aa_start": 291,
"aa_end": null,
"aa_length": 1792,
"cds_start": 873,
"cds_end": null,
"cds_length": 5379,
"cdna_start": 1169,
"cdna_end": null,
"cdna_length": 7003,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.873_928delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn292fs",
"transcript": "NM_001407899.1",
"protein_id": "NP_001394828.1",
"transcript_support_level": null,
"aa_start": 291,
"aa_end": null,
"aa_length": 1792,
"cds_start": 873,
"cds_end": null,
"cds_length": 5379,
"cdna_start": 1216,
"cdna_end": null,
"cdna_length": 7050,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.876_931delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn293fs",
"transcript": "NM_001407900.1",
"protein_id": "NP_001394829.1",
"transcript_support_level": null,
"aa_start": 292,
"aa_end": null,
"aa_length": 1792,
"cds_start": 876,
"cds_end": null,
"cds_length": 5379,
"cdna_start": 1338,
"cdna_end": null,
"cdna_length": 7169,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.876_931delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn293fs",
"transcript": "NM_001407902.1",
"protein_id": "NP_001394831.1",
"transcript_support_level": null,
"aa_start": 292,
"aa_end": null,
"aa_length": 1792,
"cds_start": 876,
"cds_end": null,
"cds_length": 5379,
"cdna_start": 1712,
"cdna_end": null,
"cdna_length": 7543,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.876_931delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn293fs",
"transcript": "NM_001407904.1",
"protein_id": "NP_001394833.1",
"transcript_support_level": null,
"aa_start": 292,
"aa_end": null,
"aa_length": 1792,
"cds_start": 876,
"cds_end": null,
"cds_length": 5379,
"cdna_start": 1232,
"cdna_end": null,
"cdna_length": 7063,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.876_931delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn293fs",
"transcript": "NM_001407906.1",
"protein_id": "NP_001394835.1",
"transcript_support_level": null,
"aa_start": 292,
"aa_end": null,
"aa_length": 1792,
"cds_start": 876,
"cds_end": null,
"cds_length": 5379,
"cdna_start": 1226,
"cdna_end": null,
"cdna_length": 7057,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.876_931delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn293fs",
"transcript": "NM_001407907.1",
"protein_id": "NP_001394836.1",
"transcript_support_level": null,
"aa_start": 292,
"aa_end": null,
"aa_length": 1792,
"cds_start": 876,
"cds_end": null,
"cds_length": 5379,
"cdna_start": 1321,
"cdna_end": null,
"cdna_length": 7152,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.876_931delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn293fs",
"transcript": "NM_001407908.1",
"protein_id": "NP_001394837.1",
"transcript_support_level": null,
"aa_start": 292,
"aa_end": null,
"aa_length": 1792,
"cds_start": 876,
"cds_end": null,
"cds_length": 5379,
"cdna_start": 1766,
"cdna_end": null,
"cdna_length": 7597,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.876_931delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn293fs",
"transcript": "NM_001407909.1",
"protein_id": "NP_001394838.1",
"transcript_support_level": null,
"aa_start": 292,
"aa_end": null,
"aa_length": 1792,
"cds_start": 876,
"cds_end": null,
"cds_length": 5379,
"cdna_start": 1226,
"cdna_end": null,
"cdna_length": 7057,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.876_931delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn293fs",
"transcript": "NM_001407910.1",
"protein_id": "NP_001394839.1",
"transcript_support_level": null,
"aa_start": 292,
"aa_end": null,
"aa_length": 1792,
"cds_start": 876,
"cds_end": null,
"cds_length": 5379,
"cdna_start": 1232,
"cdna_end": null,
"cdna_length": 7063,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.873_928delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn292fs",
"transcript": "NM_001407915.1",
"protein_id": "NP_001394844.1",
"transcript_support_level": null,
"aa_start": 291,
"aa_end": null,
"aa_length": 1791,
"cds_start": 873,
"cds_end": null,
"cds_length": 5376,
"cdna_start": 1229,
"cdna_end": null,
"cdna_length": 7060,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.873_928delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn292fs",
"transcript": "NM_001407916.1",
"protein_id": "NP_001394845.1",
"transcript_support_level": null,
"aa_start": 291,
"aa_end": null,
"aa_length": 1791,
"cds_start": 873,
"cds_end": null,
"cds_length": 5376,
"cdna_start": 1229,
"cdna_end": null,
"cdna_length": 7060,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.873_928delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn292fs",
"transcript": "NM_001407917.1",
"protein_id": "NP_001394846.1",
"transcript_support_level": null,
"aa_start": 291,
"aa_end": null,
"aa_length": 1791,
"cds_start": 873,
"cds_end": null,
"cds_length": 5376,
"cdna_start": 1437,
"cdna_end": null,
"cdna_length": 7268,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.873_928delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn292fs",
"transcript": "NM_001407918.1",
"protein_id": "NP_001394847.1",
"transcript_support_level": null,
"aa_start": 291,
"aa_end": null,
"aa_length": 1791,
"cds_start": 873,
"cds_end": null,
"cds_length": 5376,
"cdna_start": 1223,
"cdna_end": null,
"cdna_length": 7054,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407919.1",
"protein_id": "NP_001394848.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1779,
"cds_start": 963,
"cds_end": null,
"cds_length": 5340,
"cdna_start": 1665,
"cdna_end": null,
"cdna_length": 7370,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.822_877delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn275fs",
"transcript": "NM_001407920.1",
"protein_id": "NP_001394849.1",
"transcript_support_level": null,
"aa_start": 274,
"aa_end": null,
"aa_length": 1775,
"cds_start": 822,
"cds_end": null,
"cds_length": 5328,
"cdna_start": 1276,
"cdna_end": null,
"cdna_length": 7110,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.822_877delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn275fs",
"transcript": "NM_001407921.1",
"protein_id": "NP_001394850.1",
"transcript_support_level": null,
"aa_start": 274,
"aa_end": null,
"aa_length": 1775,
"cds_start": 822,
"cds_end": null,
"cds_length": 5328,
"cdna_start": 1244,
"cdna_end": null,
"cdna_length": 7078,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.822_877delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn275fs",
"transcript": "NM_001407922.1",
"protein_id": "NP_001394851.1",
"transcript_support_level": null,
"aa_start": 274,
"aa_end": null,
"aa_length": 1775,
"cds_start": 822,
"cds_end": null,
"cds_length": 5328,
"cdna_start": 1026,
"cdna_end": null,
"cdna_length": 6860,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.822_877delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn275fs",
"transcript": "NM_001407923.1",
"protein_id": "NP_001394852.1",
"transcript_support_level": null,
"aa_start": 274,
"aa_end": null,
"aa_length": 1775,
"cds_start": 822,
"cds_end": null,
"cds_length": 5328,
"cdna_start": 1250,
"cdna_end": null,
"cdna_length": 7084,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.822_877delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn275fs",
"transcript": "NM_001407924.1",
"protein_id": "NP_001394853.1",
"transcript_support_level": null,
"aa_start": 274,
"aa_end": null,
"aa_length": 1775,
"cds_start": 822,
"cds_end": null,
"cds_length": 5328,
"cdna_start": 1077,
"cdna_end": null,
"cdna_length": 6911,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.822_877delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn275fs",
"transcript": "NM_001407925.1",
"protein_id": "NP_001394854.1",
"transcript_support_level": null,
"aa_start": 274,
"aa_end": null,
"aa_length": 1775,
"cds_start": 822,
"cds_end": null,
"cds_length": 5328,
"cdna_start": 1071,
"cdna_end": null,
"cdna_length": 6905,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.822_877delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn275fs",
"transcript": "NM_001407926.1",
"protein_id": "NP_001394855.1",
"transcript_support_level": null,
"aa_start": 274,
"aa_end": null,
"aa_length": 1775,
"cds_start": 822,
"cds_end": null,
"cds_length": 5328,
"cdna_start": 1032,
"cdna_end": null,
"cdna_length": 6866,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.822_877delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn275fs",
"transcript": "NM_001407927.1",
"protein_id": "NP_001394856.1",
"transcript_support_level": null,
"aa_start": 274,
"aa_end": null,
"aa_length": 1774,
"cds_start": 822,
"cds_end": null,
"cds_length": 5325,
"cdna_start": 1250,
"cdna_end": null,
"cdna_length": 7081,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.822_877delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn275fs",
"transcript": "NM_001407928.1",
"protein_id": "NP_001394857.1",
"transcript_support_level": null,
"aa_start": 274,
"aa_end": null,
"aa_length": 1774,
"cds_start": 822,
"cds_end": null,
"cds_length": 5325,
"cdna_start": 1071,
"cdna_end": null,
"cdna_length": 6902,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.822_877delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn275fs",
"transcript": "NM_001407929.1",
"protein_id": "NP_001394858.1",
"transcript_support_level": null,
"aa_start": 274,
"aa_end": null,
"aa_length": 1774,
"cds_start": 822,
"cds_end": null,
"cds_length": 5325,
"cdna_start": 1077,
"cdna_end": null,
"cdna_length": 6908,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.819_874delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn274fs",
"transcript": "NM_001407930.1",
"protein_id": "NP_001394859.1",
"transcript_support_level": null,
"aa_start": 273,
"aa_end": null,
"aa_length": 1774,
"cds_start": 819,
"cds_end": null,
"cds_length": 5325,
"cdna_start": 1244,
"cdna_end": null,
"cdna_length": 7078,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.819_874delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn274fs",
"transcript": "NM_001407931.1",
"protein_id": "NP_001394860.1",
"transcript_support_level": null,
"aa_start": 273,
"aa_end": null,
"aa_length": 1774,
"cds_start": 819,
"cds_end": null,
"cds_length": 5325,
"cdna_start": 969,
"cdna_end": null,
"cdna_length": 6803,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.819_874delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn274fs",
"transcript": "NM_001407932.1",
"protein_id": "NP_001394861.1",
"transcript_support_level": null,
"aa_start": 273,
"aa_end": null,
"aa_length": 1774,
"cds_start": 819,
"cds_end": null,
"cds_length": 5325,
"cdna_start": 1068,
"cdna_end": null,
"cdna_length": 6902,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.822_877delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn275fs",
"transcript": "NM_001407933.1",
"protein_id": "NP_001394862.1",
"transcript_support_level": null,
"aa_start": 274,
"aa_end": null,
"aa_length": 1774,
"cds_start": 822,
"cds_end": null,
"cds_length": 5325,
"cdna_start": 1250,
"cdna_end": null,
"cdna_length": 7081,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.819_874delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn274fs",
"transcript": "NM_001407934.1",
"protein_id": "NP_001394863.1",
"transcript_support_level": null,
"aa_start": 273,
"aa_end": null,
"aa_length": 1773,
"cds_start": 819,
"cds_end": null,
"cds_length": 5322,
"cdna_start": 1245,
"cdna_end": null,
"cdna_length": 7076,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.822_877delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn275fs",
"transcript": "NM_001407935.1",
"protein_id": "NP_001394864.1",
"transcript_support_level": null,
"aa_start": 274,
"aa_end": null,
"aa_length": 1773,
"cds_start": 822,
"cds_end": null,
"cds_length": 5322,
"cdna_start": 1032,
"cdna_end": null,
"cdna_length": 6860,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.819_874delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn274fs",
"transcript": "NM_001407936.1",
"protein_id": "NP_001394865.1",
"transcript_support_level": null,
"aa_start": 273,
"aa_end": null,
"aa_length": 1773,
"cds_start": 819,
"cds_end": null,
"cds_length": 5322,
"cdna_start": 1074,
"cdna_end": null,
"cdna_length": 6905,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407937.1",
"protein_id": "NP_001394866.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1762,
"cds_start": 963,
"cds_end": null,
"cds_length": 5289,
"cdna_start": 1665,
"cdna_end": null,
"cdna_length": 7425,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407938.1",
"protein_id": "NP_001394867.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1762,
"cds_start": 963,
"cds_end": null,
"cds_length": 5289,
"cdna_start": 1125,
"cdna_end": null,
"cdna_length": 6885,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.963_1018delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn322fs",
"transcript": "NM_001407939.1",
"protein_id": "NP_001394868.1",
"transcript_support_level": null,
"aa_start": 321,
"aa_end": null,
"aa_length": 1761,
"cds_start": 963,
"cds_end": null,
"cds_length": 5286,
"cdna_start": 1665,
"cdna_end": null,
"cdna_length": 7422,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.960_1015delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn321fs",
"transcript": "NM_001407940.1",
"protein_id": "NP_001394869.1",
"transcript_support_level": null,
"aa_start": 320,
"aa_end": null,
"aa_length": 1761,
"cds_start": 960,
"cds_end": null,
"cds_length": 5286,
"cdna_start": 1122,
"cdna_end": null,
"cdna_length": 6882,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.960_1015delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn321fs",
"transcript": "NM_001407941.1",
"protein_id": "NP_001394870.1",
"transcript_support_level": null,
"aa_start": 320,
"aa_end": null,
"aa_length": 1760,
"cds_start": 960,
"cds_end": null,
"cds_length": 5283,
"cdna_start": 1662,
"cdna_end": null,
"cdna_length": 7419,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407942.1",
"protein_id": "NP_001394871.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1756,
"cds_start": 945,
"cds_end": null,
"cds_length": 5271,
"cdna_start": 1370,
"cdna_end": null,
"cdna_length": 7130,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407943.1",
"protein_id": "NP_001394872.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1755,
"cds_start": 942,
"cds_end": null,
"cds_length": 5268,
"cdna_start": 1364,
"cdna_end": null,
"cdna_length": 7124,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407944.1",
"protein_id": "NP_001394873.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1755,
"cds_start": 945,
"cds_end": null,
"cds_length": 5268,
"cdna_start": 1367,
"cdna_end": null,
"cdna_length": 7124,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.945_1000delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn316fs",
"transcript": "NM_001407945.1",
"protein_id": "NP_001394874.1",
"transcript_support_level": null,
"aa_start": 315,
"aa_end": null,
"aa_length": 1755,
"cds_start": 945,
"cds_end": null,
"cds_length": 5268,
"cdna_start": 1194,
"cdna_end": null,
"cdna_length": 6951,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.753_808delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn252fs",
"transcript": "NM_001407946.1",
"protein_id": "NP_001394875.1",
"transcript_support_level": null,
"aa_start": 251,
"aa_end": null,
"aa_length": 1752,
"cds_start": 753,
"cds_end": null,
"cds_length": 5259,
"cdna_start": 1109,
"cdna_end": null,
"cdna_length": 6943,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.753_808delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn252fs",
"transcript": "NM_001407947.1",
"protein_id": "NP_001394876.1",
"transcript_support_level": null,
"aa_start": 251,
"aa_end": null,
"aa_length": 1752,
"cds_start": 753,
"cds_end": null,
"cds_length": 5259,
"cdna_start": 1643,
"cdna_end": null,
"cdna_length": 7477,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.753_808delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn252fs",
"transcript": "NM_001407948.1",
"protein_id": "NP_001394877.1",
"transcript_support_level": null,
"aa_start": 251,
"aa_end": null,
"aa_length": 1752,
"cds_start": 753,
"cds_end": null,
"cds_length": 5259,
"cdna_start": 1198,
"cdna_end": null,
"cdna_length": 7032,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.753_808delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn252fs",
"transcript": "NM_001407949.1",
"protein_id": "NP_001394878.1",
"transcript_support_level": null,
"aa_start": 251,
"aa_end": null,
"aa_length": 1752,
"cds_start": 753,
"cds_end": null,
"cds_length": 5259,
"cdna_start": 1103,
"cdna_end": null,
"cdna_length": 6937,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.753_808delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn252fs",
"transcript": "NM_001407950.1",
"protein_id": "NP_001394879.1",
"transcript_support_level": null,
"aa_start": 251,
"aa_end": null,
"aa_length": 1751,
"cds_start": 753,
"cds_end": null,
"cds_length": 5256,
"cdna_start": 1198,
"cdna_end": null,
"cdna_length": 7029,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.753_808delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn252fs",
"transcript": "NM_001407951.1",
"protein_id": "NP_001394880.1",
"transcript_support_level": null,
"aa_start": 251,
"aa_end": null,
"aa_length": 1751,
"cds_start": 753,
"cds_end": null,
"cds_length": 5256,
"cdna_start": 1109,
"cdna_end": null,
"cdna_length": 6940,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.753_808delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn252fs",
"transcript": "NM_001407952.1",
"protein_id": "NP_001394881.1",
"transcript_support_level": null,
"aa_start": 251,
"aa_end": null,
"aa_length": 1751,
"cds_start": 753,
"cds_end": null,
"cds_length": 5256,
"cdna_start": 1185,
"cdna_end": null,
"cdna_length": 7016,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.753_808delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn252fs",
"transcript": "NM_001407953.1",
"protein_id": "NP_001394882.1",
"transcript_support_level": null,
"aa_start": 251,
"aa_end": null,
"aa_length": 1751,
"cds_start": 753,
"cds_end": null,
"cds_length": 5256,
"cdna_start": 1103,
"cdna_end": null,
"cdna_length": 6934,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.750_805delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn251fs",
"transcript": "NM_001407954.1",
"protein_id": "NP_001394883.1",
"transcript_support_level": null,
"aa_start": 250,
"aa_end": null,
"aa_length": 1751,
"cds_start": 750,
"cds_end": null,
"cds_length": 5256,
"cdna_start": 1225,
"cdna_end": null,
"cdna_length": 7059,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.750_805delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn251fs",
"transcript": "NM_001407955.1",
"protein_id": "NP_001394884.1",
"transcript_support_level": null,
"aa_start": 250,
"aa_end": null,
"aa_length": 1751,
"cds_start": 750,
"cds_end": null,
"cds_length": 5256,
"cdna_start": 1106,
"cdna_end": null,
"cdna_length": 6940,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.750_805delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn251fs",
"transcript": "NM_001407956.1",
"protein_id": "NP_001394885.1",
"transcript_support_level": null,
"aa_start": 250,
"aa_end": null,
"aa_length": 1750,
"cds_start": 750,
"cds_end": null,
"cds_length": 5253,
"cdna_start": 1640,
"cdna_end": null,
"cdna_length": 7471,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.753_808delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn252fs",
"transcript": "NM_001407957.1",
"protein_id": "NP_001394886.1",
"transcript_support_level": null,
"aa_start": 251,
"aa_end": null,
"aa_length": 1750,
"cds_start": 753,
"cds_end": null,
"cds_length": 5253,
"cdna_start": 1103,
"cdna_end": null,
"cdna_length": 6931,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.750_805delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn251fs",
"transcript": "NM_001407958.1",
"protein_id": "NP_001394887.1",
"transcript_support_level": null,
"aa_start": 250,
"aa_end": null,
"aa_length": 1750,
"cds_start": 750,
"cds_end": null,
"cds_length": 5253,
"cdna_start": 1106,
"cdna_end": null,
"cdna_length": 6937,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.705_760delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn236fs",
"transcript": "NM_001407959.1",
"protein_id": "NP_001394888.1",
"transcript_support_level": null,
"aa_start": 235,
"aa_end": null,
"aa_length": 1736,
"cds_start": 705,
"cds_end": null,
"cds_length": 5211,
"cdna_start": 1017,
"cdna_end": null,
"cdna_length": 6851,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.705_760delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn236fs",
"transcript": "NM_001407960.1",
"protein_id": "NP_001394889.1",
"transcript_support_level": null,
"aa_start": 235,
"aa_end": null,
"aa_length": 1735,
"cds_start": 705,
"cds_end": null,
"cds_length": 5208,
"cdna_start": 1077,
"cdna_end": null,
"cdna_length": 6908,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.702_757delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn235fs",
"transcript": "NM_001407962.1",
"protein_id": "NP_001394891.1",
"transcript_support_level": null,
"aa_start": 234,
"aa_end": null,
"aa_length": 1735,
"cds_start": 702,
"cds_end": null,
"cds_length": 5208,
"cdna_start": 1068,
"cdna_end": null,
"cdna_length": 6902,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.705_760delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn236fs",
"transcript": "NM_001407963.1",
"protein_id": "NP_001394892.1",
"transcript_support_level": null,
"aa_start": 235,
"aa_end": null,
"aa_length": 1734,
"cds_start": 705,
"cds_end": null,
"cds_length": 5205,
"cdna_start": 1023,
"cdna_end": null,
"cdna_length": 6851,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.942_997delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn315fs",
"transcript": "NM_001407964.1",
"protein_id": "NP_001394893.1",
"transcript_support_level": null,
"aa_start": 314,
"aa_end": null,
"aa_length": 1709,
"cds_start": 942,
"cds_end": null,
"cds_length": 5130,
"cdna_start": 1152,
"cdna_end": null,
"cdna_length": 6668,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.582_637delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn195fs",
"transcript": "NM_001407965.1",
"protein_id": "NP_001394894.1",
"transcript_support_level": null,
"aa_start": 194,
"aa_end": null,
"aa_length": 1694,
"cds_start": 582,
"cds_end": null,
"cds_length": 5085,
"cdna_start": 1169,
"cdna_end": null,
"cdna_length": 7000,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.198_253delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn67fs",
"transcript": "NM_001407966.1",
"protein_id": "NP_001394895.1",
"transcript_support_level": null,
"aa_start": 66,
"aa_end": null,
"aa_length": 1567,
"cds_start": 198,
"cds_end": null,
"cds_length": 4704,
"cdna_start": 565,
"cdna_end": null,
"cdna_length": 6399,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "ENPRDTEDVPWITLNSSIQK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.198_253delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn67fs",
"transcript": "NM_001407967.1",
"protein_id": "NP_001394896.1",
"transcript_support_level": null,
"aa_start": 66,
"aa_end": null,
"aa_length": 1566,
"cds_start": 198,
"cds_end": null,
"cds_length": 4701,
"cdna_start": 559,
"cdna_end": null,
"cdna_length": 6390,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "n.*1094_*1149delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "ENST00000700183.1",
"protein_id": "ENSP00000514850.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1778,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "n.*1094_*1149delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "ENST00000700183.1",
"protein_id": "ENSP00000514850.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1778,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407968.1",
"protein_id": "NP_001394897.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 995,
"cds_start": -4,
"cds_end": null,
"cds_length": 2988,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4478,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407969.1",
"protein_id": "NP_001394898.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 994,
"cds_start": -4,
"cds_end": null,
"cds_length": 2985,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4475,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407970.1",
"protein_id": "NP_001394899.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 782,
"cds_start": -4,
"cds_end": null,
"cds_length": 2349,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5000,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407971.1",
"protein_id": "NP_001394900.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 782,
"cds_start": -4,
"cds_end": null,
"cds_length": 2349,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3845,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.784+299_784+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407972.1",
"protein_id": "NP_001394901.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 781,
"cds_start": -4,
"cds_end": null,
"cds_length": 2346,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4376,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": 11,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407973.1",
"protein_id": "NP_001394902.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 760,
"cds_start": -4,
"cds_end": null,
"cds_length": 2283,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3945,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407974.1",
"protein_id": "NP_001394903.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 760,
"cds_start": -4,
"cds_end": null,
"cds_length": 2283,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3773,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407975.1",
"protein_id": "NP_001394904.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 760,
"cds_start": -4,
"cds_end": null,
"cds_length": 2283,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3779,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407976.1",
"protein_id": "NP_001394905.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 760,
"cds_start": -4,
"cds_end": null,
"cds_length": 2283,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3760,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407977.1",
"protein_id": "NP_001394906.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 760,
"cds_start": -4,
"cds_end": null,
"cds_length": 2283,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4313,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407978.1",
"protein_id": "NP_001394907.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 760,
"cds_start": -4,
"cds_end": null,
"cds_length": 2283,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3868,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407979.1",
"protein_id": "NP_001394908.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 759,
"cds_start": -4,
"cds_end": null,
"cds_length": 2280,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4310,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407980.1",
"protein_id": "NP_001394909.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 759,
"cds_start": -4,
"cds_end": null,
"cds_length": 2280,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3757,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407981.1",
"protein_id": "NP_001394910.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 759,
"cds_start": -4,
"cds_end": null,
"cds_length": 2280,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3865,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407982.1",
"protein_id": "NP_001394911.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 759,
"cds_start": -4,
"cds_end": null,
"cds_length": 2280,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4931,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407983.1",
"protein_id": "NP_001394912.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 759,
"cds_start": -4,
"cds_end": null,
"cds_length": 2280,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3776,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.784+299_784+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407984.1",
"protein_id": "NP_001394913.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 759,
"cds_start": -4,
"cds_end": null,
"cds_length": 2280,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3776,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.784+299_784+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407985.1",
"protein_id": "NP_001394914.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 759,
"cds_start": -4,
"cds_end": null,
"cds_length": 2280,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3770,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.784+299_784+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407986.1",
"protein_id": "NP_001394915.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 759,
"cds_start": -4,
"cds_end": null,
"cds_length": 2280,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4310,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407990.1",
"protein_id": "NP_001394919.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 759,
"cds_start": -4,
"cds_end": null,
"cds_length": 2280,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3770,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.784+299_784+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407991.1",
"protein_id": "NP_001394920.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 759,
"cds_start": -4,
"cds_end": null,
"cds_length": 2280,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3763,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.784+299_784+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407992.1",
"protein_id": "NP_001394921.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 759,
"cds_start": -4,
"cds_end": null,
"cds_length": 2280,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3865,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001407993.1",
"protein_id": "NP_001394922.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 759,
"cds_start": -4,
"cds_end": null,
"cds_length": 2280,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3757,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_007298.4",
"protein_id": "NP_009229.2",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 759,
"cds_start": -4,
"cds_end": null,
"cds_length": 2280,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3865,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "ENST00000491747.6",
"protein_id": "ENSP00000420705.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 759,
"cds_start": -4,
"cds_end": null,
"cds_length": 2280,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2379,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.784+299_784+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408392.1",
"protein_id": "NP_001395321.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 758,
"cds_start": -4,
"cds_end": null,
"cds_length": 2277,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4307,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.784+299_784+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408396.1",
"protein_id": "NP_001395325.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 758,
"cds_start": -4,
"cds_end": null,
"cds_length": 2277,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3767,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.784+299_784+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408397.1",
"protein_id": "NP_001395326.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 758,
"cds_start": -4,
"cds_end": null,
"cds_length": 2277,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3754,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.784+299_784+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408398.1",
"protein_id": "NP_001395327.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 758,
"cds_start": -4,
"cds_end": null,
"cds_length": 2277,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3862,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.784+299_784+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408399.1",
"protein_id": "NP_001395328.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 758,
"cds_start": -4,
"cds_end": null,
"cds_length": 2277,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3773,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.784+299_784+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408400.1",
"protein_id": "NP_001395329.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 758,
"cds_start": -4,
"cds_end": null,
"cds_length": 2277,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4307,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.784+299_784+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408401.1",
"protein_id": "NP_001395330.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 758,
"cds_start": -4,
"cds_end": null,
"cds_length": 2277,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3767,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.784+299_784+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408402.1",
"protein_id": "NP_001395331.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 758,
"cds_start": -4,
"cds_end": null,
"cds_length": 2277,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3773,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408403.1",
"protein_id": "NP_001395332.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 758,
"cds_start": -4,
"cds_end": null,
"cds_length": 2277,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3773,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408404.1",
"protein_id": "NP_001395333.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 758,
"cds_start": -4,
"cds_end": null,
"cds_length": 2277,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3767,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.790+296_790+351delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408406.1",
"protein_id": "NP_001395335.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 757,
"cds_start": -4,
"cds_end": null,
"cds_length": 2274,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3770,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.784+299_784+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408407.1",
"protein_id": "NP_001395336.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 757,
"cds_start": -4,
"cds_end": null,
"cds_length": 2274,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3770,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.778+299_778+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408408.1",
"protein_id": "NP_001395337.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 757,
"cds_start": -4,
"cds_end": null,
"cds_length": 2274,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3764,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.709+299_709+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408409.1",
"protein_id": "NP_001395338.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 756,
"cds_start": -4,
"cds_end": null,
"cds_length": 2271,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3767,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 25,
"intron_rank": 11,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.646+299_646+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408410.1",
"protein_id": "NP_001395339.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 735,
"cds_start": -4,
"cds_end": null,
"cds_length": 2208,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4498,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.709+299_709+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408411.1",
"protein_id": "NP_001395340.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 734,
"cds_start": -4,
"cds_end": null,
"cds_length": 2205,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4235,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.709+299_709+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408412.1",
"protein_id": "NP_001395341.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 733,
"cds_start": -4,
"cds_end": null,
"cds_length": 2202,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3692,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.706+299_706+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408413.1",
"protein_id": "NP_001395342.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 733,
"cds_start": -4,
"cds_end": null,
"cds_length": 2202,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3698,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.709+299_709+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408414.1",
"protein_id": "NP_001395343.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 733,
"cds_start": -4,
"cds_end": null,
"cds_length": 2202,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4232,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.709+299_709+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408415.1",
"protein_id": "NP_001395344.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 733,
"cds_start": -4,
"cds_end": null,
"cds_length": 2202,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4853,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.706+299_706+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408416.1",
"protein_id": "NP_001395345.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 733,
"cds_start": -4,
"cds_end": null,
"cds_length": 2202,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3787,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.670+1401_670+1456delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408418.1",
"protein_id": "NP_001395347.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 721,
"cds_start": -4,
"cds_end": null,
"cds_length": 2166,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3751,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.670+1401_670+1456delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408419.1",
"protein_id": "NP_001395348.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 721,
"cds_start": -4,
"cds_end": null,
"cds_length": 2166,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3662,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.670+1401_670+1456delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408420.1",
"protein_id": "NP_001395349.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 721,
"cds_start": -4,
"cds_end": null,
"cds_length": 2166,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3656,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.670+1401_670+1456delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "ENST00000352993.7",
"protein_id": "ENSP00000312236.5",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 721,
"cds_start": -4,
"cds_end": null,
"cds_length": 2166,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3668,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.667+1401_667+1456delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408421.1",
"protein_id": "NP_001395350.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 720,
"cds_start": -4,
"cds_end": null,
"cds_length": 2163,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3646,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.670+1401_670+1456delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408422.1",
"protein_id": "NP_001395351.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 720,
"cds_start": -4,
"cds_end": null,
"cds_length": 2163,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3831,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.670+1401_670+1456delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408423.1",
"protein_id": "NP_001395352.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 720,
"cds_start": -4,
"cds_end": null,
"cds_length": 2163,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3653,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.667+1401_667+1456delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408424.1",
"protein_id": "NP_001395353.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 720,
"cds_start": -4,
"cds_end": null,
"cds_length": 2163,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3659,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.664+299_664+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408425.1",
"protein_id": "NP_001395354.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 719,
"cds_start": -4,
"cds_end": null,
"cds_length": 2160,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3656,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.664+299_664+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408426.1",
"protein_id": "NP_001395355.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 719,
"cds_start": -4,
"cds_end": null,
"cds_length": 2160,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4811,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.664+299_664+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408427.1",
"protein_id": "NP_001395356.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 719,
"cds_start": -4,
"cds_end": null,
"cds_length": 2160,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3643,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.664+299_664+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408428.1",
"protein_id": "NP_001395357.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 719,
"cds_start": -4,
"cds_end": null,
"cds_length": 2160,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3745,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.664+299_664+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408429.1",
"protein_id": "NP_001395358.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 719,
"cds_start": -4,
"cds_end": null,
"cds_length": 2160,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4190,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.664+299_664+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408430.1",
"protein_id": "NP_001395359.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 719,
"cds_start": -4,
"cds_end": null,
"cds_length": 2160,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3650,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.667+1401_667+1456delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408431.1",
"protein_id": "NP_001395360.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 719,
"cds_start": -4,
"cds_end": null,
"cds_length": 2160,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3656,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.661+299_661+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408432.1",
"protein_id": "NP_001395361.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 718,
"cds_start": -4,
"cds_end": null,
"cds_length": 2157,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3653,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.661+299_661+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408433.1",
"protein_id": "NP_001395362.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 718,
"cds_start": -4,
"cds_end": null,
"cds_length": 2157,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4187,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.661+299_661+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408434.1",
"protein_id": "NP_001395363.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 718,
"cds_start": -4,
"cds_end": null,
"cds_length": 2157,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3742,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.661+299_661+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408435.1",
"protein_id": "NP_001395364.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 718,
"cds_start": -4,
"cds_end": null,
"cds_length": 2157,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3647,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.664+299_664+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408436.1",
"protein_id": "NP_001395365.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 718,
"cds_start": -4,
"cds_end": null,
"cds_length": 2157,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3634,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.664+299_664+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408437.1",
"protein_id": "NP_001395366.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 718,
"cds_start": -4,
"cds_end": null,
"cds_length": 2157,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4187,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.664+299_664+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408438.1",
"protein_id": "NP_001395367.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 718,
"cds_start": -4,
"cds_end": null,
"cds_length": 2157,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3647,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.664+299_664+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408439.1",
"protein_id": "NP_001395368.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 718,
"cds_start": -4,
"cds_end": null,
"cds_length": 2157,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3653,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.664+299_664+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408440.1",
"protein_id": "NP_001395369.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 718,
"cds_start": -4,
"cds_end": null,
"cds_length": 2157,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3742,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.664+299_664+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408441.1",
"protein_id": "NP_001395370.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 718,
"cds_start": -4,
"cds_end": null,
"cds_length": 2157,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4187,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.664+299_664+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408442.1",
"protein_id": "NP_001395371.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 718,
"cds_start": -4,
"cds_end": null,
"cds_length": 2157,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4808,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.664+299_664+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408443.1",
"protein_id": "NP_001395372.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 718,
"cds_start": -4,
"cds_end": null,
"cds_length": 2157,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3653,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.664+299_664+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408444.1",
"protein_id": "NP_001395373.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 718,
"cds_start": -4,
"cds_end": null,
"cds_length": 2157,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3647,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.661+299_661+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408445.1",
"protein_id": "NP_001395374.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 717,
"cds_start": -4,
"cds_end": null,
"cds_length": 2154,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3650,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.661+299_661+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408446.1",
"protein_id": "NP_001395375.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 717,
"cds_start": -4,
"cds_end": null,
"cds_length": 2154,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3644,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.661+299_661+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408447.1",
"protein_id": "NP_001395376.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 717,
"cds_start": -4,
"cds_end": null,
"cds_length": 2154,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4184,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.661+299_661+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408448.1",
"protein_id": "NP_001395377.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 717,
"cds_start": -4,
"cds_end": null,
"cds_length": 2154,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3637,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.661+299_661+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408450.1",
"protein_id": "NP_001395379.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 717,
"cds_start": -4,
"cds_end": null,
"cds_length": 2154,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3739,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.664+299_664+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "ENST00000484087.6",
"protein_id": "ENSP00000419481.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 717,
"cds_start": -4,
"cds_end": null,
"cds_length": 2154,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2490,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.652+299_652+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408451.1",
"protein_id": "NP_001395380.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 715,
"cds_start": -4,
"cds_end": null,
"cds_length": 2148,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3638,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": 11,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.646+299_646+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408452.1",
"protein_id": "NP_001395381.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 713,
"cds_start": -4,
"cds_end": null,
"cds_length": 2142,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3892,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.646+299_646+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408453.1",
"protein_id": "NP_001395382.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 713,
"cds_start": -4,
"cds_end": null,
"cds_length": 2142,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3674,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.646+299_646+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408454.1",
"protein_id": "NP_001395383.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 713,
"cds_start": -4,
"cds_end": null,
"cds_length": 2142,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3725,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": 11,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.646+299_646+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408455.1",
"protein_id": "NP_001395384.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 713,
"cds_start": -4,
"cds_end": null,
"cds_length": 2142,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3889,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": 11,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.646+299_646+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408456.1",
"protein_id": "NP_001395385.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 713,
"cds_start": -4,
"cds_end": null,
"cds_length": 2142,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3895,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.646+299_646+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408457.1",
"protein_id": "NP_001395386.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 713,
"cds_start": -4,
"cds_end": null,
"cds_length": 2142,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3626,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.646+299_646+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "ENST00000493919.6",
"protein_id": "ENSP00000418819.2",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 713,
"cds_start": -4,
"cds_end": null,
"cds_length": 2142,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3757,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": 11,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.646+299_646+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "ENST00000644555.2",
"protein_id": "ENSP00000494614.2",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 713,
"cds_start": -4,
"cds_end": null,
"cds_length": 2142,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3921,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.646+299_646+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408458.1",
"protein_id": "NP_001395387.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 712,
"cds_start": -4,
"cds_end": null,
"cds_length": 2139,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3785,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.646+299_646+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408459.1",
"protein_id": "NP_001395388.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 712,
"cds_start": -4,
"cds_end": null,
"cds_length": 2139,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3716,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.646+299_646+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408460.1",
"protein_id": "NP_001395389.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 712,
"cds_start": -4,
"cds_end": null,
"cds_length": 2139,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3722,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.646+299_646+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408461.1",
"protein_id": "NP_001395390.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 712,
"cds_start": -4,
"cds_end": null,
"cds_length": 2139,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3703,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": 11,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.643+299_643+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408462.1",
"protein_id": "NP_001395391.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 712,
"cds_start": -4,
"cds_end": null,
"cds_length": 2139,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3984,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": 11,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.643+299_643+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408463.1",
"protein_id": "NP_001395392.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 712,
"cds_start": -4,
"cds_end": null,
"cds_length": 2139,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3895,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.643+299_643+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408464.1",
"protein_id": "NP_001395393.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 712,
"cds_start": -4,
"cds_end": null,
"cds_length": 2139,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3716,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": 11,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.643+299_643+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408465.1",
"protein_id": "NP_001395394.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 712,
"cds_start": -4,
"cds_end": null,
"cds_length": 2139,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3896,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": 11,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.646+299_646+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408466.1",
"protein_id": "NP_001395395.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 712,
"cds_start": -4,
"cds_end": null,
"cds_length": 2139,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3889,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.646+299_646+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408467.1",
"protein_id": "NP_001395396.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 712,
"cds_start": -4,
"cds_end": null,
"cds_length": 2139,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3716,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": 11,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.643+299_643+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408468.1",
"protein_id": "NP_001395397.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 711,
"cds_start": -4,
"cds_end": null,
"cds_length": 2136,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3883,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.646+299_646+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408469.1",
"protein_id": "NP_001395398.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 711,
"cds_start": -4,
"cds_end": null,
"cds_length": 2136,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3668,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.643+299_643+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408470.1",
"protein_id": "NP_001395399.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 711,
"cds_start": -4,
"cds_end": null,
"cds_length": 2136,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3668,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408472.1",
"protein_id": "NP_001395401.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 699,
"cds_start": -4,
"cds_end": null,
"cds_length": 2100,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3696,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.787+299_787+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_007299.4",
"protein_id": "NP_009230.2",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 699,
"cds_start": -4,
"cds_end": null,
"cds_length": 2100,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3696,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.784+299_784+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408473.1",
"protein_id": "NP_001395402.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 698,
"cds_start": -4,
"cds_end": null,
"cds_length": 2097,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3699,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.586+299_586+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408474.1",
"protein_id": "NP_001395403.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 693,
"cds_start": -4,
"cds_end": null,
"cds_length": 2082,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3578,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.583+299_583+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408475.1",
"protein_id": "NP_001395404.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 692,
"cds_start": -4,
"cds_end": null,
"cds_length": 2079,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3569,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.586+299_586+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408476.1",
"protein_id": "NP_001395405.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 692,
"cds_start": -4,
"cds_end": null,
"cds_length": 2079,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3575,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.577+299_577+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408478.1",
"protein_id": "NP_001395407.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 690,
"cds_start": -4,
"cds_end": null,
"cds_length": 2073,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3846,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.577+299_577+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408479.1",
"protein_id": "NP_001395408.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 690,
"cds_start": -4,
"cds_end": null,
"cds_length": 2073,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3757,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.577+299_577+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408480.1",
"protein_id": "NP_001395409.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 690,
"cds_start": -4,
"cds_end": null,
"cds_length": 2073,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3751,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.577+299_577+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408481.1",
"protein_id": "NP_001395410.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 689,
"cds_start": -4,
"cds_end": null,
"cds_length": 2070,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3748,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": 11,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.577+299_577+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408482.1",
"protein_id": "NP_001395411.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 689,
"cds_start": -4,
"cds_end": null,
"cds_length": 2070,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3899,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.577+299_577+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408483.1",
"protein_id": "NP_001395412.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 689,
"cds_start": -4,
"cds_end": null,
"cds_length": 2070,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4909,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.577+299_577+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408484.1",
"protein_id": "NP_001395413.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 689,
"cds_start": -4,
"cds_end": null,
"cds_length": 2070,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3843,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.577+299_577+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408485.1",
"protein_id": "NP_001395414.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 689,
"cds_start": -4,
"cds_end": null,
"cds_length": 2070,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4288,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.577+299_577+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408489.1",
"protein_id": "NP_001395418.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 689,
"cds_start": -4,
"cds_end": null,
"cds_length": 2070,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3754,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.574+299_574+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408490.1",
"protein_id": "NP_001395419.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 689,
"cds_start": -4,
"cds_end": null,
"cds_length": 2070,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3754,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.574+299_574+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408491.1",
"protein_id": "NP_001395420.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 689,
"cds_start": -4,
"cds_end": null,
"cds_length": 2070,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3748,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": 11,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.577+299_577+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408492.1",
"protein_id": "NP_001395421.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 688,
"cds_start": -4,
"cds_end": null,
"cds_length": 2067,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3861,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.574+299_574+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408493.1",
"protein_id": "NP_001395422.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 688,
"cds_start": -4,
"cds_end": null,
"cds_length": 2067,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3751,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.548-3413_548-3358delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408494.1",
"protein_id": "NP_001395423.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 680,
"cds_start": -4,
"cds_end": null,
"cds_length": 2043,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3533,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.545-3413_545-3358delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408495.1",
"protein_id": "NP_001395424.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 678,
"cds_start": -4,
"cds_end": null,
"cds_length": 2037,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3520,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.523+299_523+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408496.1",
"protein_id": "NP_001395425.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 672,
"cds_start": -4,
"cds_end": null,
"cds_length": 2019,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3602,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.523+299_523+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408497.1",
"protein_id": "NP_001395426.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 672,
"cds_start": -4,
"cds_end": null,
"cds_length": 2019,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3773,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.523+299_523+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408498.1",
"protein_id": "NP_001395427.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 672,
"cds_start": -4,
"cds_end": null,
"cds_length": 2019,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3596,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.523+299_523+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408499.1",
"protein_id": "NP_001395428.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 672,
"cds_start": -4,
"cds_end": null,
"cds_length": 2019,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3775,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.523+299_523+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408500.1",
"protein_id": "NP_001395429.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 672,
"cds_start": -4,
"cds_end": null,
"cds_length": 2019,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3769,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.523+299_523+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408501.1",
"protein_id": "NP_001395430.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 672,
"cds_start": -4,
"cds_end": null,
"cds_length": 2019,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3766,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.454+299_454+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408502.1",
"protein_id": "NP_001395431.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 671,
"cds_start": -4,
"cds_end": null,
"cds_length": 2016,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3700,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.520+299_520+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408503.1",
"protein_id": "NP_001395432.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 671,
"cds_start": -4,
"cds_end": null,
"cds_length": 2016,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3766,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.520+299_520+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408504.1",
"protein_id": "NP_001395433.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 671,
"cds_start": -4,
"cds_end": null,
"cds_length": 2016,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3772,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.520+299_520+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408505.1",
"protein_id": "NP_001395434.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 670,
"cds_start": -4,
"cds_end": null,
"cds_length": 2013,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3551,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.460+1401_460+1456delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408506.1",
"protein_id": "NP_001395435.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 651,
"cds_start": -4,
"cds_end": null,
"cds_length": 1956,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3634,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.460+1401_460+1456delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408507.1",
"protein_id": "NP_001395436.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 650,
"cds_start": -4,
"cds_end": null,
"cds_length": 1953,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3624,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.451+299_451+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408508.1",
"protein_id": "NP_001395437.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 647,
"cds_start": -4,
"cds_end": null,
"cds_length": 1944,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3622,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.451+299_451+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408509.1",
"protein_id": "NP_001395438.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 646,
"cds_start": -4,
"cds_end": null,
"cds_length": 1941,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3619,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.406+299_406+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408510.1",
"protein_id": "NP_001395439.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 633,
"cds_start": -4,
"cds_end": null,
"cds_length": 1902,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3596,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.404-3413_404-3358delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408511.1",
"protein_id": "NP_001395440.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 632,
"cds_start": -4,
"cds_end": null,
"cds_length": 1899,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3383,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": 6,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.283+299_283+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408512.1",
"protein_id": "NP_001395441.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 592,
"cds_start": -4,
"cds_end": null,
"cds_length": 1779,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3473,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 11,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.577+299_577+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408513.1",
"protein_id": "NP_001395442.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 583,
"cds_start": -4,
"cds_end": null,
"cds_length": 1752,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3549,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.706+299_706+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "ENST00000700182.1",
"protein_id": "ENSP00000514849.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 544,
"cds_start": -4,
"cds_end": null,
"cds_length": 1635,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2269,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "c.577+299_577+354delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "NM_001408514.1",
"protein_id": "NP_001395443.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 451,
"cds_start": -4,
"cds_end": null,
"cds_length": 1356,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3574,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"hgvs_c": "n.*960_*1015delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": null,
"transcript": "ENST00000642945.1",
"protein_id": "ENSP00000495897.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1255,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "BRCA1",
"gene_hgnc_id": 1100,
"dbsnp": "rs80359875",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 5.762,
"phylop100way_prediction": "Uncertain_significance",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 16,
"acmg_classification": "Pathogenic",
"acmg_criteria": "PVS1,PP5_Very_Strong",
"acmg_by_gene": [
{
"score": 16,
"benign_score": 0,
"pathogenic_score": 16,
"criteria": [
"PVS1",
"PP5_Very_Strong"
],
"verdict": "Pathogenic",
"transcript": "ENST00000357654.9",
"gene_symbol": "BRCA1",
"hgnc_id": 1100,
"effects": [
"frameshift_variant"
],
"inheritance_mode": "AR,AD",
"hgvs_c": "c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA",
"hgvs_p": "p.Asn363fs"
}
],
"clinvar_disease": " 1, familial, susceptibility to,Breast-ovarian cancer,Hereditary breast ovarian cancer syndrome,Hereditary cancer-predisposing syndrome,not provided",
"clinvar_classification": "Pathogenic",
"clinvar_review_status": "reviewed by expert panel",
"clinvar_submissions_summary": "P:7",
"phenotype_combined": "Breast-ovarian cancer, familial, susceptibility to, 1|Hereditary breast ovarian cancer syndrome|Hereditary cancer-predisposing syndrome|not provided",
"pathogenicity_classification_combined": "Pathogenic",
"custom_annotations": null
}
],
"message": null
}