← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 19-11113683-ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG-A (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=19&pos=11113683&ref=ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG&alt=A&genome=hg38&allGenes=true"
API Response
json
{
"variants": [
{
"chr": "19",
"pos": 11113683,
"ref": "ACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG",
"alt": "A",
"effect": "frameshift_variant",
"transcript": "ENST00000558518.6",
"consequences": [
{
"aa_ref": "VKRKTLFRENGSKPRA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LDLR",
"gene_hgnc_id": 6547,
"hgvs_c": "c.1516_1562delGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGGGC",
"hgvs_p": "p.Val506fs",
"transcript": "NM_000527.5",
"protein_id": "NP_000518.1",
"transcript_support_level": null,
"aa_start": 506,
"aa_end": null,
"aa_length": 860,
"cds_start": 1516,
"cds_end": null,
"cds_length": 2583,
"cdna_start": 1602,
"cdna_end": null,
"cdna_length": 5173,
"mane_select": "ENST00000558518.6",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VKRKTLFRENGSKPRA",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LDLR",
"gene_hgnc_id": 6547,
"hgvs_c": "c.1516_1562delGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGGGC",
"hgvs_p": "p.Val506fs",
"transcript": "ENST00000558518.6",
"protein_id": "ENSP00000454071.1",
"transcript_support_level": 1,
"aa_start": 506,
"aa_end": null,
"aa_length": 860,
"cds_start": 1516,
"cds_end": null,
"cds_length": 2583,
"cdna_start": 1602,
"cdna_end": null,
"cdna_length": 5173,
"mane_select": "NM_000527.5",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VKRKTLFRENGSKPRA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LDLR",
"gene_hgnc_id": 6547,
"hgvs_c": "c.1774_1820delGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGGGC",
"hgvs_p": "p.Val592fs",
"transcript": "ENST00000252444.10",
"protein_id": "ENSP00000252444.6",
"transcript_support_level": 1,
"aa_start": 592,
"aa_end": null,
"aa_length": 946,
"cds_start": 1774,
"cds_end": null,
"cds_length": 2841,
"cdna_start": 1790,
"cdna_end": null,
"cdna_length": 5357,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VKRKTLFRENGSKPRA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LDLR",
"gene_hgnc_id": 6547,
"hgvs_c": "c.1516_1562delGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGGGC",
"hgvs_p": "p.Val506fs",
"transcript": "ENST00000558013.5",
"protein_id": "ENSP00000453346.1",
"transcript_support_level": 1,
"aa_start": 506,
"aa_end": null,
"aa_length": 858,
"cds_start": 1516,
"cds_end": null,
"cds_length": 2577,
"cdna_start": 1587,
"cdna_end": null,
"cdna_length": 3144,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VKRKTLFRENGSKPRA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LDLR",
"gene_hgnc_id": 6547,
"hgvs_c": "c.1516_1562delGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGGGC",
"hgvs_p": "p.Val506fs",
"transcript": "ENST00000557933.5",
"protein_id": "ENSP00000453557.1",
"transcript_support_level": 5,
"aa_start": 506,
"aa_end": null,
"aa_length": 948,
"cds_start": 1516,
"cds_end": null,
"cds_length": 2847,
"cdna_start": 1603,
"cdna_end": null,
"cdna_length": 2941,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VKRKTLFRENGSKPRA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LDLR",
"gene_hgnc_id": 6547,
"hgvs_c": "c.1516_1562delGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGGGC",
"hgvs_p": "p.Val506fs",
"transcript": "NM_001195798.2",
"protein_id": "NP_001182727.1",
"transcript_support_level": null,
"aa_start": 506,
"aa_end": null,
"aa_length": 858,
"cds_start": 1516,
"cds_end": null,
"cds_length": 2577,
"cdna_start": 1602,
"cdna_end": null,
"cdna_length": 5167,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VKRKTLFRENGSKPRA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LDLR",
"gene_hgnc_id": 6547,
"hgvs_c": "c.1396_1442delGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGGGC",
"hgvs_p": "p.Val466fs",
"transcript": "ENST00000560467.2",
"protein_id": "ENSP00000453513.2",
"transcript_support_level": 3,
"aa_start": 466,
"aa_end": null,
"aa_length": 820,
"cds_start": 1396,
"cds_end": null,
"cds_length": 2463,
"cdna_start": 1481,
"cdna_end": null,
"cdna_length": 5048,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VKRKTLFRENGSKPRA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LDLR",
"gene_hgnc_id": 6547,
"hgvs_c": "c.1393_1439delGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGGGC",
"hgvs_p": "p.Val465fs",
"transcript": "NM_001195799.2",
"protein_id": "NP_001182728.1",
"transcript_support_level": null,
"aa_start": 465,
"aa_end": null,
"aa_length": 819,
"cds_start": 1393,
"cds_end": null,
"cds_length": 2460,
"cdna_start": 1479,
"cdna_end": null,
"cdna_length": 5050,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VKRKTLFRENGSKPRA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LDLR",
"gene_hgnc_id": 6547,
"hgvs_c": "c.1393_1439delGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGGGC",
"hgvs_p": "p.Val465fs",
"transcript": "ENST00000535915.5",
"protein_id": "ENSP00000440520.1",
"transcript_support_level": 2,
"aa_start": 465,
"aa_end": null,
"aa_length": 819,
"cds_start": 1393,
"cds_end": null,
"cds_length": 2460,
"cdna_start": 1479,
"cdna_end": null,
"cdna_length": 2768,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VKRKTLFRENGSKPRA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LDLR",
"gene_hgnc_id": 6547,
"hgvs_c": "c.1012_1058delGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGGGC",
"hgvs_p": "p.Val338fs",
"transcript": "NM_001195800.2",
"protein_id": "NP_001182729.1",
"transcript_support_level": null,
"aa_start": 338,
"aa_end": null,
"aa_length": 692,
"cds_start": 1012,
"cds_end": null,
"cds_length": 2079,
"cdna_start": 1098,
"cdna_end": null,
"cdna_length": 4669,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VKRKTLFRENGSKPRA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LDLR",
"gene_hgnc_id": 6547,
"hgvs_c": "c.1012_1058delGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGGGC",
"hgvs_p": "p.Val338fs",
"transcript": "ENST00000455727.6",
"protein_id": "ENSP00000397829.2",
"transcript_support_level": 2,
"aa_start": 338,
"aa_end": null,
"aa_length": 692,
"cds_start": 1012,
"cds_end": null,
"cds_length": 2079,
"cdna_start": 1098,
"cdna_end": null,
"cdna_length": 2333,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VKRKTLFRENGSKPRA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LDLR",
"gene_hgnc_id": 6547,
"hgvs_c": "c.1135_1181delGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGGGC",
"hgvs_p": "p.Val379fs",
"transcript": "NM_001195803.2",
"protein_id": "NP_001182732.1",
"transcript_support_level": null,
"aa_start": 379,
"aa_end": null,
"aa_length": 682,
"cds_start": 1135,
"cds_end": null,
"cds_length": 2049,
"cdna_start": 1221,
"cdna_end": null,
"cdna_length": 4639,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VKRKTLFRENGSKPRA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LDLR",
"gene_hgnc_id": 6547,
"hgvs_c": "c.1135_1181delGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGGGC",
"hgvs_p": "p.Val379fs",
"transcript": "ENST00000545707.5",
"protein_id": "ENSP00000437639.1",
"transcript_support_level": 2,
"aa_start": 379,
"aa_end": null,
"aa_length": 682,
"cds_start": 1135,
"cds_end": null,
"cds_length": 2049,
"cdna_start": 1221,
"cdna_end": null,
"cdna_length": 2429,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VKRKTLFRENGSKPRA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LDLR",
"gene_hgnc_id": 6547,
"hgvs_c": "c.1516_1562delGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGGGC",
"hgvs_p": "p.Val506fs",
"transcript": "XM_011528010.3",
"protein_id": "XP_011526312.1",
"transcript_support_level": null,
"aa_start": 506,
"aa_end": null,
"aa_length": 834,
"cds_start": 1516,
"cds_end": null,
"cds_length": 2505,
"cdna_start": 1602,
"cdna_end": null,
"cdna_length": 5095,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VKRKTLFRENGSKPRA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LDLR",
"gene_hgnc_id": 6547,
"hgvs_c": "c.1516_1562delGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGGGC",
"hgvs_p": "p.Val506fs",
"transcript": "XM_047438831.1",
"protein_id": "XP_047294787.1",
"transcript_support_level": null,
"aa_start": 506,
"aa_end": null,
"aa_length": 596,
"cds_start": 1516,
"cds_end": null,
"cds_length": 1791,
"cdna_start": 1602,
"cdna_end": null,
"cdna_length": 1933,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LDLR",
"gene_hgnc_id": 6547,
"hgvs_c": "n.1516_1562delGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGGGC",
"hgvs_p": null,
"transcript": "ENST00000559340.2",
"protein_id": "ENSP00000453696.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5054,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LDLR",
"gene_hgnc_id": 6547,
"hgvs_c": "n.1135_1181delGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGGGC",
"hgvs_p": null,
"transcript": "ENST00000713991.1",
"protein_id": "ENSP00000519281.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4922,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LDLR",
"gene_hgnc_id": 6547,
"hgvs_c": "n.*203_*249delCCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG",
"hgvs_p": null,
"transcript": "ENST00000560173.1",
"protein_id": null,
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 389,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 1,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MIR6886",
"gene_hgnc_id": 50121,
"hgvs_c": "n.*150_*196delCCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG",
"hgvs_p": null,
"transcript": "ENST00000619864.1",
"protein_id": null,
"transcript_support_level": 6,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 61,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 1,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MIR6886",
"gene_hgnc_id": 50121,
"hgvs_c": "n.*150_*196delCCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG",
"hgvs_p": null,
"transcript": "NR_106946.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 61,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": null,
"protein_coding": false,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 1,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MIR6886",
"gene_hgnc_id": 50121,
"hgvs_c": "n.*185_*231delCCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG",
"hgvs_p": null,
"transcript": "unassigned_transcript_3225",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 21,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": null,
"protein_coding": false,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 1,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MIR6886",
"gene_hgnc_id": 50121,
"hgvs_c": "n.*153_*199delCCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG",
"hgvs_p": null,
"transcript": "unassigned_transcript_3226",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 21,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "LDLR",
"gene_hgnc_id": 6547,
"dbsnp": "rs879254927",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 9.879,
"phylop100way_prediction": "Pathogenic",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 10,
"acmg_classification": "Pathogenic",
"acmg_criteria": "PVS1,PP5_Moderate",
"acmg_by_gene": [
{
"score": 10,
"benign_score": 0,
"pathogenic_score": 10,
"criteria": [
"PVS1",
"PP5_Moderate"
],
"verdict": "Pathogenic",
"transcript": "ENST00000558518.6",
"gene_symbol": "LDLR",
"hgnc_id": 6547,
"effects": [
"frameshift_variant"
],
"inheritance_mode": "AD,AR,SD",
"hgvs_c": "c.1516_1562delGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGGGC",
"hgvs_p": "p.Val506fs"
},
{
"score": 3,
"benign_score": 0,
"pathogenic_score": 3,
"criteria": [
"PP3",
"PP5_Moderate"
],
"verdict": "Uncertain_significance",
"transcript": "NR_106946.1",
"gene_symbol": "MIR6886",
"hgnc_id": 50121,
"effects": [
"downstream_gene_variant"
],
"inheritance_mode": "",
"hgvs_c": "n.*150_*196delCCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAG",
"hgvs_p": null
}
],
"clinvar_disease": " 1, familial,Hypercholesterolemia",
"clinvar_classification": "Pathogenic",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "P:1",
"phenotype_combined": "Hypercholesterolemia, familial, 1",
"pathogenicity_classification_combined": "Pathogenic",
"custom_annotations": null
}
],
"message": null
}