← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 19-55154064-TGGGCCCGCAGGTCCAGGGACTCCTTAGCCC-T (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=19&pos=55154064&ref=TGGGCCCGCAGGTCCAGGGACTCCTTAGCCC&alt=T&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "19",
"pos": 55154064,
"ref": "TGGGCCCGCAGGTCCAGGGACTCCTTAGCCC",
"alt": "T",
"effect": "disruptive_inframe_deletion",
"transcript": "ENST00000344887.10",
"consequences": [
{
"aa_ref": "RAKESLDLRAH",
"aa_alt": "H",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TNNI3",
"gene_hgnc_id": 11947,
"hgvs_c": "c.485_514delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC",
"hgvs_p": "p.Arg162_Ala171del",
"transcript": "NM_000363.5",
"protein_id": "NP_000354.4",
"transcript_support_level": null,
"aa_start": 162,
"aa_end": null,
"aa_length": 210,
"cds_start": 485,
"cds_end": null,
"cds_length": 633,
"cdna_start": 657,
"cdna_end": null,
"cdna_length": 843,
"mane_select": "ENST00000344887.10",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RAKESLDLRAH",
"aa_alt": "H",
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TNNI3",
"gene_hgnc_id": 11947,
"hgvs_c": "c.485_514delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC",
"hgvs_p": "p.Arg162_Ala171del",
"transcript": "ENST00000344887.10",
"protein_id": "ENSP00000341838.5",
"transcript_support_level": 1,
"aa_start": 162,
"aa_end": null,
"aa_length": 210,
"cds_start": 485,
"cds_end": null,
"cds_length": 633,
"cdna_start": 657,
"cdna_end": null,
"cdna_length": 843,
"mane_select": "NM_000363.5",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RAKESLDLRAH",
"aa_alt": "H",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TNNI3",
"gene_hgnc_id": 11947,
"hgvs_c": "c.518_547delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC",
"hgvs_p": "p.Arg173_Ala182del",
"transcript": "ENST00000665070.1",
"protein_id": "ENSP00000499482.1",
"transcript_support_level": null,
"aa_start": 173,
"aa_end": null,
"aa_length": 221,
"cds_start": 518,
"cds_end": null,
"cds_length": 666,
"cdna_start": 690,
"cdna_end": null,
"cdna_length": 871,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RAKESLDLRAH",
"aa_alt": "H",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TNNI3",
"gene_hgnc_id": 11947,
"hgvs_c": "c.473_502delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC",
"hgvs_p": "p.Arg158_Ala167del",
"transcript": "ENST00000714238.1",
"protein_id": "ENSP00000519518.1",
"transcript_support_level": null,
"aa_start": 158,
"aa_end": null,
"aa_length": 206,
"cds_start": 473,
"cds_end": null,
"cds_length": 621,
"cdna_start": 645,
"cdna_end": null,
"cdna_length": 831,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RAKESLDLRAH",
"aa_alt": "H",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TNNI3",
"gene_hgnc_id": 11947,
"hgvs_c": "c.443_472delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC",
"hgvs_p": "p.Arg148_Ala157del",
"transcript": "ENST00000714236.1",
"protein_id": "ENSP00000519516.1",
"transcript_support_level": null,
"aa_start": 148,
"aa_end": null,
"aa_length": 196,
"cds_start": 443,
"cds_end": null,
"cds_length": 591,
"cdna_start": 615,
"cdna_end": null,
"cdna_length": 801,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RAKESLDLRAH",
"aa_alt": "H",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TNNI3",
"gene_hgnc_id": 11947,
"hgvs_c": "c.410_439delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC",
"hgvs_p": "p.Arg137_Ala146del",
"transcript": "ENST00000588882.1",
"protein_id": "ENSP00000466729.1",
"transcript_support_level": 2,
"aa_start": 137,
"aa_end": null,
"aa_length": 185,
"cds_start": 410,
"cds_end": null,
"cds_length": 558,
"cdna_start": 487,
"cdna_end": null,
"cdna_length": 669,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RAKESLDLRAH",
"aa_alt": "H",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TNNI3",
"gene_hgnc_id": 11947,
"hgvs_c": "c.401_430delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC",
"hgvs_p": "p.Arg134_Ala143del",
"transcript": "ENST00000714237.1",
"protein_id": "ENSP00000519517.1",
"transcript_support_level": null,
"aa_start": 134,
"aa_end": null,
"aa_length": 182,
"cds_start": 401,
"cds_end": null,
"cds_length": 549,
"cdna_start": 573,
"cdna_end": null,
"cdna_length": 759,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RAKESLDLRAH",
"aa_alt": "H",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TNNI3",
"gene_hgnc_id": 11947,
"hgvs_c": "c.278_307delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC",
"hgvs_p": "p.Arg93_Ala102del",
"transcript": "ENST00000714240.1",
"protein_id": "ENSP00000519520.1",
"transcript_support_level": null,
"aa_start": 93,
"aa_end": null,
"aa_length": 141,
"cds_start": 278,
"cds_end": null,
"cds_length": 426,
"cdna_start": 355,
"cdna_end": null,
"cdna_length": 537,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TNNI3",
"gene_hgnc_id": 11947,
"hgvs_c": "n.484_513delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC",
"hgvs_p": null,
"transcript": "ENST00000585806.5",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 699,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TNNI3",
"gene_hgnc_id": 11947,
"hgvs_c": "n.*256_*285delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC",
"hgvs_p": null,
"transcript": "ENST00000586858.2",
"protein_id": "ENSP00000465258.2",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 774,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TNNI3",
"gene_hgnc_id": 11947,
"hgvs_c": "n.313_342delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC",
"hgvs_p": null,
"transcript": "ENST00000589864.1",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 525,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TNNI3",
"gene_hgnc_id": 11947,
"hgvs_c": "n.*159_*188delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC",
"hgvs_p": null,
"transcript": "ENST00000714239.1",
"protein_id": "ENSP00000519519.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 787,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TNNI3",
"gene_hgnc_id": 11947,
"hgvs_c": "n.*256_*285delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC",
"hgvs_p": null,
"transcript": "ENST00000586858.2",
"protein_id": "ENSP00000465258.2",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 774,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TNNI3",
"gene_hgnc_id": 11947,
"hgvs_c": "n.*159_*188delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC",
"hgvs_p": null,
"transcript": "ENST00000714239.1",
"protein_id": "ENSP00000519519.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 787,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "TNNI3",
"gene_hgnc_id": 11947,
"hgvs_c": "n.371+647_371+676delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC",
"hgvs_p": null,
"transcript": "ENST00000714235.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 397,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TNNI3",
"gene_hgnc_id": 11947,
"hgvs_c": "n.*16_*45delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC",
"hgvs_p": null,
"transcript": "ENST00000586669.5",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 477,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TNNI3",
"gene_hgnc_id": 11947,
"hgvs_c": "n.*211_*240delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC",
"hgvs_p": null,
"transcript": "ENST00000587176.5",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 992,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "TNNI3",
"gene_hgnc_id": 11947,
"dbsnp": "rs1555863489",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 9.883,
"phylop100way_prediction": "Pathogenic",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 5,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "PM1,PM4,PP3",
"acmg_by_gene": [
{
"score": 5,
"benign_score": 0,
"pathogenic_score": 5,
"criteria": [
"PM1",
"PM4",
"PP3"
],
"verdict": "Uncertain_significance",
"transcript": "ENST00000344887.10",
"gene_symbol": "TNNI3",
"hgnc_id": 11947,
"effects": [
"disruptive_inframe_deletion"
],
"inheritance_mode": "AD,AR",
"hgvs_c": "c.485_514delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC",
"hgvs_p": "p.Arg162_Ala171del"
}
],
"clinvar_disease": "Hypertrophic cardiomyopathy",
"clinvar_classification": "Uncertain significance",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "US:1",
"phenotype_combined": "Hypertrophic cardiomyopathy",
"pathogenicity_classification_combined": "Uncertain significance",
"custom_annotations": null
}
],
"message": null
}