← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 2-144404859-TCTGGCGTGCCAAGGCGAGA-T (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=2&pos=144404859&ref=TCTGGCGTGCCAAGGCGAGA&alt=T&genome=hg38&allGenes=true"
API Response
json
{
"variants": [
{
"chr": "2",
"pos": 144404859,
"ref": "TCTGGCGTGCCAAGGCGAGA",
"alt": "T",
"effect": "frameshift_variant",
"transcript": "ENST00000627532.3",
"consequences": [
{
"aa_ref": "SRLGTPE",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.550_568delTCTCGCCTTGGCACGCCAG",
"hgvs_p": "p.Ser184fs",
"transcript": "NM_014795.4",
"protein_id": "NP_055610.1",
"transcript_support_level": null,
"aa_start": 184,
"aa_end": null,
"aa_length": 1214,
"cds_start": 550,
"cds_end": null,
"cds_length": 3645,
"cdna_start": 818,
"cdna_end": null,
"cdna_length": 9265,
"mane_select": "ENST00000627532.3",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SRLGTPE",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.550_568delTCTCGCCTTGGCACGCCAG",
"hgvs_p": "p.Ser184fs",
"transcript": "ENST00000627532.3",
"protein_id": "ENSP00000487174.1",
"transcript_support_level": 1,
"aa_start": 184,
"aa_end": null,
"aa_length": 1214,
"cds_start": 550,
"cds_end": null,
"cds_length": 3645,
"cdna_start": 818,
"cdna_end": null,
"cdna_length": 9265,
"mane_select": "NM_014795.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SRLGTPE",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.550_568delTCTCGCCTTGGCACGCCAG",
"hgvs_p": "p.Ser184fs",
"transcript": "ENST00000558170.6",
"protein_id": "ENSP00000454157.1",
"transcript_support_level": 1,
"aa_start": 184,
"aa_end": null,
"aa_length": 1214,
"cds_start": 550,
"cds_end": null,
"cds_length": 3645,
"cdna_start": 769,
"cdna_end": null,
"cdna_length": 4012,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SRLGTPE",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.547_565delTCTCGCCTTGGCACGCCAG",
"hgvs_p": "p.Ser183fs",
"transcript": "ENST00000303660.8",
"protein_id": "ENSP00000302501.4",
"transcript_support_level": 1,
"aa_start": 183,
"aa_end": null,
"aa_length": 1213,
"cds_start": 547,
"cds_end": null,
"cds_length": 3642,
"cdna_start": 702,
"cdna_end": null,
"cdna_length": 3913,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SRLGTPE",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.637_655delTCTCGCCTTGGCACGCCAG",
"hgvs_p": "p.Ser213fs",
"transcript": "ENST00000427902.5",
"protein_id": "ENSP00000395496.2",
"transcript_support_level": 1,
"aa_start": 213,
"aa_end": null,
"aa_length": 730,
"cds_start": 637,
"cds_end": null,
"cds_length": 2194,
"cdna_start": 697,
"cdna_end": null,
"cdna_length": 2236,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SRLGTPE",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.634_652delTCTCGCCTTGGCACGCCAG",
"hgvs_p": "p.Ser212fs",
"transcript": "ENST00000392861.6",
"protein_id": "ENSP00000376601.3",
"transcript_support_level": 1,
"aa_start": 212,
"aa_end": null,
"aa_length": 466,
"cds_start": 634,
"cds_end": null,
"cds_length": 1401,
"cdna_start": 765,
"cdna_end": null,
"cdna_length": 1514,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SRLGTPE",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.550_568delTCTCGCCTTGGCACGCCAG",
"hgvs_p": "p.Ser184fs",
"transcript": "ENST00000636471.1",
"protein_id": "ENSP00000490317.1",
"transcript_support_level": 5,
"aa_start": 184,
"aa_end": null,
"aa_length": 1239,
"cds_start": 550,
"cds_end": null,
"cds_length": 3720,
"cdna_start": 1061,
"cdna_end": null,
"cdna_length": 9583,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SRLGTPE",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.550_568delTCTCGCCTTGGCACGCCAG",
"hgvs_p": "p.Ser184fs",
"transcript": "ENST00000409487.7",
"protein_id": "ENSP00000386854.2",
"transcript_support_level": 5,
"aa_start": 184,
"aa_end": null,
"aa_length": 1214,
"cds_start": 550,
"cds_end": null,
"cds_length": 3645,
"cdna_start": 851,
"cdna_end": null,
"cdna_length": 5361,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SRLGTPE",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.550_568delTCTCGCCTTGGCACGCCAG",
"hgvs_p": "p.Ser184fs",
"transcript": "ENST00000636026.2",
"protein_id": "ENSP00000490776.1",
"transcript_support_level": 5,
"aa_start": 184,
"aa_end": null,
"aa_length": 1202,
"cds_start": 550,
"cds_end": null,
"cds_length": 3609,
"cdna_start": 1097,
"cdna_end": null,
"cdna_length": 5172,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SRLGTPE",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.478_496delTCTCGCCTTGGCACGCCAG",
"hgvs_p": "p.Ser160fs",
"transcript": "NM_001171653.2",
"protein_id": "NP_001165124.1",
"transcript_support_level": null,
"aa_start": 160,
"aa_end": null,
"aa_length": 1190,
"cds_start": 478,
"cds_end": null,
"cds_length": 3573,
"cdna_start": 746,
"cdna_end": null,
"cdna_length": 9193,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SRLGTPE",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.478_496delTCTCGCCTTGGCACGCCAG",
"hgvs_p": "p.Ser160fs",
"transcript": "ENST00000539609.7",
"protein_id": "ENSP00000443792.2",
"transcript_support_level": 2,
"aa_start": 160,
"aa_end": null,
"aa_length": 1190,
"cds_start": 478,
"cds_end": null,
"cds_length": 3573,
"cdna_start": 746,
"cdna_end": null,
"cdna_length": 4061,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SRLGTPE",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.214_232delTCTCGCCTTGGCACGCCAG",
"hgvs_p": "p.Ser72fs",
"transcript": "ENST00000636413.1",
"protein_id": "ENSP00000490508.1",
"transcript_support_level": 5,
"aa_start": 72,
"aa_end": null,
"aa_length": 1102,
"cds_start": 214,
"cds_end": null,
"cds_length": 3309,
"cdna_start": 537,
"cdna_end": null,
"cdna_length": 8984,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SRLGTPE",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.214_232delTCTCGCCTTGGCACGCCAG",
"hgvs_p": "p.Ser72fs",
"transcript": "ENST00000637045.1",
"protein_id": "ENSP00000490141.1",
"transcript_support_level": 5,
"aa_start": 72,
"aa_end": null,
"aa_length": 1102,
"cds_start": 214,
"cds_end": null,
"cds_length": 3309,
"cdna_start": 644,
"cdna_end": null,
"cdna_length": 9091,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SRLGTPE",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.214_232delTCTCGCCTTGGCACGCCAG",
"hgvs_p": "p.Ser72fs",
"transcript": "ENST00000637304.1",
"protein_id": "ENSP00000490872.1",
"transcript_support_level": 5,
"aa_start": 72,
"aa_end": null,
"aa_length": 1102,
"cds_start": 214,
"cds_end": null,
"cds_length": 3309,
"cdna_start": 711,
"cdna_end": null,
"cdna_length": 9158,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SRLGTPE",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.214_232delTCTCGCCTTGGCACGCCAG",
"hgvs_p": "p.Ser72fs",
"transcript": "ENST00000638007.1",
"protein_id": "ENSP00000490723.1",
"transcript_support_level": 5,
"aa_start": 72,
"aa_end": null,
"aa_length": 1102,
"cds_start": 214,
"cds_end": null,
"cds_length": 3309,
"cdna_start": 693,
"cdna_end": null,
"cdna_length": 9140,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SRLGTPE",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.214_232delTCTCGCCTTGGCACGCCAG",
"hgvs_p": "p.Ser72fs",
"transcript": "ENST00000638087.1",
"protein_id": "ENSP00000490673.1",
"transcript_support_level": 5,
"aa_start": 72,
"aa_end": null,
"aa_length": 1102,
"cds_start": 214,
"cds_end": null,
"cds_length": 3309,
"cdna_start": 892,
"cdna_end": null,
"cdna_length": 9339,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SRLGTPE",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.550_568delTCTCGCCTTGGCACGCCAG",
"hgvs_p": "p.Ser184fs",
"transcript": "ENST00000637267.2",
"protein_id": "ENSP00000490293.2",
"transcript_support_level": 5,
"aa_start": 184,
"aa_end": null,
"aa_length": 611,
"cds_start": 550,
"cds_end": null,
"cds_length": 1836,
"cdna_start": 1409,
"cdna_end": null,
"cdna_length": 2677,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "SRLGTPE",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.478_496delTCTCGCCTTGGCACGCCAG",
"hgvs_p": "p.Ser160fs",
"transcript": "ENST00000431672.4",
"protein_id": "ENSP00000475267.2",
"transcript_support_level": 4,
"aa_start": 160,
"aa_end": null,
"aa_length": 183,
"cds_start": 478,
"cds_end": null,
"cds_length": 553,
"cdna_start": 652,
"cdna_end": null,
"cdna_length": 709,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "n.496_514delTCTCGCCTTGGCACGCCAG",
"hgvs_p": null,
"transcript": "ENST00000497268.1",
"protein_id": null,
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 674,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "n.519_537delTCTCGCCTTGGCACGCCAG",
"hgvs_p": null,
"transcript": "ENST00000636179.1",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8984,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "n.*267_*285delTCTCGCCTTGGCACGCCAG",
"hgvs_p": null,
"transcript": "ENST00000636732.2",
"protein_id": "ENSP00000490175.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5073,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "n.650_668delTCTCGCCTTGGCACGCCAG",
"hgvs_p": null,
"transcript": "ENST00000636820.1",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 9115,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "n.*399_*417delTCTCGCCTTGGCACGCCAG",
"hgvs_p": null,
"transcript": "ENST00000689298.1",
"protein_id": "ENSP00000508434.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4090,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.-228_-210delTCTCGCCTTGGCACGCCAG",
"hgvs_p": null,
"transcript": "ENST00000440875.6",
"protein_id": "ENSP00000475553.3",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 955,
"cds_start": -4,
"cds_end": null,
"cds_length": 2868,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4939,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.-228_-210delTCTCGCCTTGGCACGCCAG",
"hgvs_p": null,
"transcript": "ENST00000638128.1",
"protein_id": "ENSP00000490934.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 955,
"cds_start": -4,
"cds_end": null,
"cds_length": 2868,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8932,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "n.*267_*285delTCTCGCCTTGGCACGCCAG",
"hgvs_p": null,
"transcript": "ENST00000636732.2",
"protein_id": "ENSP00000490175.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5073,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "n.*399_*417delTCTCGCCTTGGCACGCCAG",
"hgvs_p": null,
"transcript": "ENST00000689298.1",
"protein_id": "ENSP00000508434.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4090,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.-133-6028_-133-6010delTCTCGCCTTGGCACGCCAG",
"hgvs_p": null,
"transcript": "ENST00000675069.1",
"protein_id": "ENSP00000502467.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 391,
"cds_start": -4,
"cds_end": null,
"cds_length": 1176,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2203,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.332-748_332-730delTCTCGCCTTGGCACGCCAG",
"hgvs_p": null,
"transcript": "ENST00000419938.5",
"protein_id": "ENSP00000394777.2",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 220,
"cds_start": -4,
"cds_end": null,
"cds_length": 663,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1755,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.*125_*143delTCTCGCCTTGGCACGCCAG",
"hgvs_p": null,
"transcript": "ENST00000465308.5",
"protein_id": "ENSP00000487476.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 140,
"cds_start": -4,
"cds_end": null,
"cds_length": 425,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1071,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"hgvs_c": "c.*118_*136delTCTCGCCTTGGCACGCCAG",
"hgvs_p": null,
"transcript": "ENST00000409211.5",
"protein_id": "ENSP00000387256.2",
"transcript_support_level": 4,
"aa_start": null,
"aa_end": null,
"aa_length": 119,
"cds_start": -4,
"cds_end": null,
"cds_length": 360,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 587,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "ZEB2",
"gene_hgnc_id": 14881,
"dbsnp": "rs587784568",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 9.917,
"phylop100way_prediction": "Pathogenic",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 10,
"acmg_classification": "Pathogenic",
"acmg_criteria": "PVS1,PP5_Moderate",
"acmg_by_gene": [
{
"score": 10,
"benign_score": 0,
"pathogenic_score": 10,
"criteria": [
"PVS1",
"PP5_Moderate"
],
"verdict": "Pathogenic",
"transcript": "ENST00000627532.3",
"gene_symbol": "ZEB2",
"hgnc_id": 14881,
"effects": [
"frameshift_variant"
],
"inheritance_mode": "AD",
"hgvs_c": "c.550_568delTCTCGCCTTGGCACGCCAG",
"hgvs_p": "p.Ser184fs"
}
],
"clinvar_disease": "Mowat-Wilson syndrome",
"clinvar_classification": "Pathogenic",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "P:1",
"phenotype_combined": "Mowat-Wilson syndrome",
"pathogenicity_classification_combined": "Pathogenic",
"custom_annotations": null
}
],
"message": null
}