← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 2-166054631-CACTTACGCAAATGTAATGACAGTGAAATCGAGCCAGTTCCATGGATCCCG-C (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=2&pos=166054631&ref=CACTTACGCAAATGTAATGACAGTGAAATCGAGCCAGTTCCATGGATCCCG&alt=C&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "2",
"pos": 166054631,
"ref": "CACTTACGCAAATGTAATGACAGTGAAATCGAGCCAGTTCCATGGATCCCG",
"alt": "C",
"effect": "frameshift_variant,splice_donor_variant,splice_region_variant,intron_variant",
"transcript": "ENST00000674923.1",
"consequences": [
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "NM_001165963.4",
"protein_id": "NP_001159435.1",
"transcript_support_level": null,
"aa_start": 187,
"aa_end": null,
"aa_length": 2009,
"cds_start": 559,
"cds_end": null,
"cds_length": 6030,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 11940,
"mane_select": "ENST00000674923.1",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "ENST00000674923.1",
"protein_id": "ENSP00000501589.1",
"transcript_support_level": null,
"aa_start": 187,
"aa_end": null,
"aa_length": 2009,
"cds_start": 559,
"cds_end": null,
"cds_length": 6030,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 11940,
"mane_select": "NM_001165963.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "ENST00000303395.9",
"protein_id": "ENSP00000303540.4",
"transcript_support_level": 5,
"aa_start": 187,
"aa_end": null,
"aa_length": 2009,
"cds_start": 559,
"cds_end": null,
"cds_length": 6030,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 11853,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 26,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "ENST00000375405.7",
"protein_id": "ENSP00000364554.3",
"transcript_support_level": 5,
"aa_start": 187,
"aa_end": null,
"aa_length": 1998,
"cds_start": 559,
"cds_end": null,
"cds_length": 5997,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8097,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "ENST00000409050.2",
"protein_id": "ENSP00000386312.1",
"transcript_support_level": 5,
"aa_start": 187,
"aa_end": null,
"aa_length": 1981,
"cds_start": 559,
"cds_end": null,
"cds_length": 5946,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7376,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_region_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.-1867_-1824+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": null,
"transcript": "NM_001353961.2",
"protein_id": "NP_001340890.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1195,
"cds_start": -4,
"cds_end": null,
"cds_length": 3588,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 13008,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "n.*349_*392+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": null,
"transcript": "ENST00000636759.1",
"protein_id": "ENSP00000490895.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3606,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "n.*113_*156+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": null,
"transcript": "ENST00000641996.1",
"protein_id": "ENSP00000493054.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12903,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "NM_001202435.3",
"protein_id": "NP_001189364.1",
"transcript_support_level": null,
"aa_start": 187,
"aa_end": null,
"aa_length": 2009,
"cds_start": 559,
"cds_end": null,
"cds_length": 6030,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12890,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "NM_001353948.2",
"protein_id": "NP_001340877.1",
"transcript_support_level": null,
"aa_start": 187,
"aa_end": null,
"aa_length": 2009,
"cds_start": 559,
"cds_end": null,
"cds_length": 6030,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12933,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "NM_001353949.2",
"protein_id": "NP_001340878.1",
"transcript_support_level": null,
"aa_start": 187,
"aa_end": null,
"aa_length": 1998,
"cds_start": 559,
"cds_end": null,
"cds_length": 5997,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12765,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "NM_001353950.2",
"protein_id": "NP_001340879.1",
"transcript_support_level": null,
"aa_start": 187,
"aa_end": null,
"aa_length": 1998,
"cds_start": 559,
"cds_end": null,
"cds_length": 5997,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12857,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "NM_001353951.2",
"protein_id": "NP_001340880.1",
"transcript_support_level": null,
"aa_start": 187,
"aa_end": null,
"aa_length": 1998,
"cds_start": 559,
"cds_end": null,
"cds_length": 5997,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12900,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "NM_001353952.2",
"protein_id": "NP_001340881.1",
"transcript_support_level": null,
"aa_start": 187,
"aa_end": null,
"aa_length": 1998,
"cds_start": 559,
"cds_end": null,
"cds_length": 5997,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12992,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "NM_006920.6",
"protein_id": "NP_008851.3",
"transcript_support_level": null,
"aa_start": 187,
"aa_end": null,
"aa_length": 1998,
"cds_start": 559,
"cds_end": null,
"cds_length": 5997,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 13079,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "ENST00000635750.1",
"protein_id": "ENSP00000490799.1",
"transcript_support_level": 5,
"aa_start": 187,
"aa_end": null,
"aa_length": 1998,
"cds_start": 559,
"cds_end": null,
"cds_length": 5997,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8299,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "ENST00000637988.1",
"protein_id": "ENSP00000490780.1",
"transcript_support_level": 5,
"aa_start": 187,
"aa_end": null,
"aa_length": 1998,
"cds_start": 559,
"cds_end": null,
"cds_length": 5997,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8562,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 26,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "ENST00000640036.1",
"protein_id": "ENSP00000491573.1",
"transcript_support_level": 5,
"aa_start": 187,
"aa_end": null,
"aa_length": 1998,
"cds_start": 559,
"cds_end": null,
"cds_length": 5997,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8131,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "NM_001353954.2",
"protein_id": "NP_001340883.1",
"transcript_support_level": null,
"aa_start": 187,
"aa_end": null,
"aa_length": 1997,
"cds_start": 559,
"cds_end": null,
"cds_length": 5994,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12989,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "NM_001353955.2",
"protein_id": "NP_001340884.1",
"transcript_support_level": null,
"aa_start": 187,
"aa_end": null,
"aa_length": 1997,
"cds_start": 559,
"cds_end": null,
"cds_length": 5994,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12897,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "ENST00000641575.1",
"protein_id": "ENSP00000492917.1",
"transcript_support_level": null,
"aa_start": 187,
"aa_end": null,
"aa_length": 1997,
"cds_start": 559,
"cds_end": null,
"cds_length": 5994,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12874,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "NM_001165964.3",
"protein_id": "NP_001159436.1",
"transcript_support_level": null,
"aa_start": 187,
"aa_end": null,
"aa_length": 1981,
"cds_start": 559,
"cds_end": null,
"cds_length": 5946,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12941,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "NM_001353957.2",
"protein_id": "NP_001340886.1",
"transcript_support_level": null,
"aa_start": 187,
"aa_end": null,
"aa_length": 1981,
"cds_start": 559,
"cds_end": null,
"cds_length": 5946,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12849,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "NM_001353958.2",
"protein_id": "NP_001340887.1",
"transcript_support_level": null,
"aa_start": 187,
"aa_end": null,
"aa_length": 1981,
"cds_start": 559,
"cds_end": null,
"cds_length": 5946,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12806,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "NM_001353960.2",
"protein_id": "NP_001340889.1",
"transcript_support_level": null,
"aa_start": 187,
"aa_end": null,
"aa_length": 1980,
"cds_start": 559,
"cds_end": null,
"cds_length": 5943,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12938,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.346_389+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg116fs",
"transcript": "ENST00000713692.1",
"protein_id": "ENSP00000518996.1",
"transcript_support_level": null,
"aa_start": 116,
"aa_end": null,
"aa_length": 1927,
"cds_start": 346,
"cds_end": null,
"cds_length": 5784,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7757,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 26,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "ENST00000641603.1",
"protein_id": "ENSP00000492945.1",
"transcript_support_level": null,
"aa_start": 187,
"aa_end": null,
"aa_length": 1915,
"cds_start": 559,
"cds_end": null,
"cds_length": 5748,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12506,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 26,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "ENST00000635776.1",
"protein_id": "ENSP00000490692.1",
"transcript_support_level": 5,
"aa_start": 187,
"aa_end": null,
"aa_length": 1618,
"cds_start": 559,
"cds_end": null,
"cds_length": 4857,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 10107,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_donor_variant",
"splice_region_variant",
"5_prime_UTR_variant",
"intron_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.-1867_-1824+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": null,
"transcript": "NM_001353961.2",
"protein_id": "NP_001340890.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1195,
"cds_start": -4,
"cds_end": null,
"cds_length": 3588,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 13008,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "SCN1A-AS1",
"gene_hgnc_id": 54069,
"hgvs_c": "n.116-4771_116-4722delACTTACGCAAATGTAATGACAGTGAAATCGAGCCAGTTCCATGGATCCCG",
"hgvs_p": null,
"transcript": "ENST00000595268.3",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 567,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "SCN1A-AS1",
"gene_hgnc_id": 54069,
"hgvs_c": "n.424+27403_424+27452delACTTACGCAAATGTAATGACAGTGAAATCGAGCCAGTTCCATGGATCCCG",
"hgvs_p": null,
"transcript": "ENST00000595647.5",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 910,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "SCN1A-AS1",
"gene_hgnc_id": 54069,
"hgvs_c": "n.221+18502_221+18551delACTTACGCAAATGTAATGACAGTGAAATCGAGCCAGTTCCATGGATCCCG",
"hgvs_p": null,
"transcript": "ENST00000599041.5",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 806,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "SCN1A-AS1",
"gene_hgnc_id": 54069,
"hgvs_c": "n.154+18502_154+18551delACTTACGCAAATGTAATGACAGTGAAATCGAGCCAGTTCCATGGATCCCG",
"hgvs_p": null,
"transcript": "ENST00000627027.2",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 637,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "SCN1A-AS1",
"gene_hgnc_id": 54069,
"hgvs_c": "n.318+18502_318+18551delACTTACGCAAATGTAATGACAGTGAAATCGAGCCAGTTCCATGGATCCCG",
"hgvs_p": null,
"transcript": "ENST00000628933.2",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 780,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "SCN1A-AS1",
"gene_hgnc_id": 54069,
"hgvs_c": "n.1043-20656_1043-20607delACTTACGCAAATGTAATGACAGTGAAATCGAGCCAGTTCCATGGATCCCG",
"hgvs_p": null,
"transcript": "ENST00000629609.2",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1520,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "SCN1A-AS1",
"gene_hgnc_id": 54069,
"hgvs_c": "n.268+27403_268+27452delACTTACGCAAATGTAATGACAGTGAAATCGAGCCAGTTCCATGGATCCCG",
"hgvs_p": null,
"transcript": "ENST00000630226.2",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 616,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"splice_donor_variant",
"splice_region_variant",
"intron_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "n.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": null,
"transcript": "ENST00000636194.1",
"protein_id": "ENSP00000490288.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8508,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"splice_donor_variant",
"splice_region_variant",
"3_prime_UTR_variant",
"intron_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "n.*349_*392+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": null,
"transcript": "ENST00000636759.1",
"protein_id": "ENSP00000490895.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3606,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"splice_donor_variant",
"splice_region_variant",
"intron_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "n.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": null,
"transcript": "ENST00000637038.2",
"protein_id": "ENSP00000490184.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8426,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"splice_donor_variant",
"splice_region_variant",
"intron_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "n.811_854+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": null,
"transcript": "ENST00000637968.1",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4614,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"splice_donor_variant",
"splice_region_variant",
"3_prime_UTR_variant",
"intron_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "n.*113_*156+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": null,
"transcript": "ENST00000641996.1",
"protein_id": "ENSP00000493054.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12903,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 6,
"intron_rank_end": null,
"gene_symbol": "SCN1A-AS1",
"gene_hgnc_id": 54069,
"hgvs_c": "n.842-5497_842-5448delACTTACGCAAATGTAATGACAGTGAAATCGAGCCAGTTCCATGGATCCCG",
"hgvs_p": null,
"transcript": "ENST00000651562.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2390,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "SCN1A-AS1",
"gene_hgnc_id": 54069,
"hgvs_c": "n.487+18502_487+18551delACTTACGCAAATGTAATGACAGTGAAATCGAGCCAGTTCCATGGATCCCG",
"hgvs_p": null,
"transcript": "ENST00000651574.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2258,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 6,
"intron_rank_end": null,
"gene_symbol": "SCN1A-AS1",
"gene_hgnc_id": 54069,
"hgvs_c": "n.811-5494_811-5445delACTTACGCAAATGTAATGACAGTGAAATCGAGCCAGTTCCATGGATCCCG",
"hgvs_p": null,
"transcript": "ENST00000651673.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3468,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "SCN1A-AS1",
"gene_hgnc_id": 54069,
"hgvs_c": "n.523-22456_523-22407delACTTACGCAAATGTAATGACAGTGAAATCGAGCCAGTTCCATGGATCCCG",
"hgvs_p": null,
"transcript": "ENST00000671284.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2445,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"splice_donor_variant",
"splice_region_variant",
"intron_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "n.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": null,
"transcript": "ENST00000671940.1",
"protein_id": "ENSP00000500336.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8315,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"splice_donor_variant",
"splice_region_variant",
"intron_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "n.3032_3075+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": null,
"transcript": "ENST00000673490.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 10569,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"splice_donor_variant",
"splice_region_variant",
"intron_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 26,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "n.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": null,
"transcript": "ENST00000689288.1",
"protein_id": "ENSP00000509637.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8258,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"splice_donor_variant",
"splice_region_variant",
"intron_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "n.945_988+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": null,
"transcript": "NR_148667.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 13051,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "XM_047445392.1",
"protein_id": "XP_047301348.1",
"transcript_support_level": null,
"aa_start": 187,
"aa_end": null,
"aa_length": 2008,
"cds_start": 559,
"cds_end": null,
"cds_length": 6027,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 13022,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "RDPWNWLDFTVITFA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs",
"transcript": "XM_047445393.1",
"protein_id": "XP_047301349.1",
"transcript_support_level": null,
"aa_start": 187,
"aa_end": null,
"aa_length": 1398,
"cds_start": 559,
"cds_end": null,
"cds_length": 4197,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4676,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"non_coding_transcript_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"hgvs_c": "c.-1867_-1824+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": null,
"transcript": "NM_001353961.2",
"protein_id": "NP_001340890.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1195,
"cds_start": -4,
"cds_end": null,
"cds_length": 3588,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 13008,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "SCN1A",
"gene_hgnc_id": 10585,
"dbsnp": "rs1553551304",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 9.999,
"phylop100way_prediction": "Pathogenic",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 10,
"acmg_classification": "Pathogenic",
"acmg_criteria": "PVS1,PP5_Moderate",
"acmg_by_gene": [
{
"score": 10,
"benign_score": 0,
"pathogenic_score": 10,
"criteria": [
"PVS1",
"PP5_Moderate"
],
"verdict": "Pathogenic",
"transcript": "ENST00000674923.1",
"gene_symbol": "SCN1A",
"hgnc_id": 10585,
"effects": [
"frameshift_variant",
"splice_donor_variant",
"splice_region_variant",
"intron_variant"
],
"inheritance_mode": "AD,Unknown",
"hgvs_c": "c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT",
"hgvs_p": "p.Arg187fs"
},
{
"score": 3,
"benign_score": 0,
"pathogenic_score": 3,
"criteria": [
"PP3",
"PP5_Moderate"
],
"verdict": "Uncertain_significance",
"transcript": "ENST00000651562.1",
"gene_symbol": "SCN1A-AS1",
"hgnc_id": 54069,
"effects": [
"intron_variant"
],
"inheritance_mode": "",
"hgvs_c": "n.842-5497_842-5448delACTTACGCAAATGTAATGACAGTGAAATCGAGCCAGTTCCATGGATCCCG",
"hgvs_p": null
}
],
"clinvar_disease": "not provided",
"clinvar_classification": "Pathogenic",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "P:1",
"phenotype_combined": "not provided",
"pathogenicity_classification_combined": "Pathogenic",
"custom_annotations": null
}
],
"message": null
}