← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 2-178608199-TGGGATCTGAAGGTGGACTGAACTTTCCA-GGGATCTGTTTTGGGATCTG (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=2&pos=178608199&ref=TGGGATCTGAAGGTGGACTGAACTTTCCA&alt=GGGATCTGTTTTGGGATCTG&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "2",
"pos": 178608199,
"ref": "TGGGATCTGAAGGTGGACTGAACTTTCCA",
"alt": "GGGATCTGTTTTGGGATCTG",
"effect": "missense_variant,disruptive_inframe_deletion",
"transcript": "ENST00000589042.5",
"consequences": [
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 363,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.52656_52684delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly17553_Lys17562delinsArgSerGlnAsnArgSerGln",
"transcript": "NM_001267550.2",
"protein_id": "NP_001254479.2",
"transcript_support_level": null,
"aa_start": 17552,
"aa_end": null,
"aa_length": 35991,
"cds_start": 52656,
"cds_end": null,
"cds_length": 107976,
"cdna_start": 52909,
"cdna_end": null,
"cdna_length": 109224,
"mane_select": "ENST00000589042.5",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 363,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.52656_52684delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly17553_Lys17562delinsArgSerGlnAsnArgSerGln",
"transcript": "ENST00000589042.5",
"protein_id": "ENSP00000467141.1",
"transcript_support_level": 5,
"aa_start": 17552,
"aa_end": null,
"aa_length": 35991,
"cds_start": 52656,
"cds_end": null,
"cds_length": 107976,
"cdna_start": 52909,
"cdna_end": null,
"cdna_length": 109224,
"mane_select": "NM_001267550.2",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 361,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.52500_52528delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly17501_Lys17510delinsArgSerGlnAsnArgSerGln",
"transcript": "ENST00000446966.2",
"protein_id": "ENSP00000408004.2",
"transcript_support_level": 1,
"aa_start": 17500,
"aa_end": null,
"aa_length": 35939,
"cds_start": 52500,
"cds_end": null,
"cds_length": 107820,
"cdna_start": 52753,
"cdna_end": null,
"cdna_length": 109068,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 361,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.52380_52408delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly17461_Lys17470delinsArgSerGlnAsnArgSerGln",
"transcript": "ENST00000436599.2",
"protein_id": "ENSP00000405517.2",
"transcript_support_level": 1,
"aa_start": 17460,
"aa_end": null,
"aa_length": 35899,
"cds_start": 52380,
"cds_end": null,
"cds_length": 107700,
"cdna_start": 52633,
"cdna_end": null,
"cdna_length": 108948,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 356,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.52098_52126delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly17367_Lys17376delinsArgSerGlnAsnArgSerGln",
"transcript": "ENST00000426232.6",
"protein_id": "ENSP00000392336.2",
"transcript_support_level": 1,
"aa_start": 17366,
"aa_end": null,
"aa_length": 35805,
"cds_start": 52098,
"cds_end": null,
"cds_length": 107418,
"cdna_start": 52351,
"cdna_end": null,
"cdna_length": 108666,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 365,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.52656_52684delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly17553_Lys17562delinsArgSerGlnAsnArgSerGln",
"transcript": "ENST00000412264.2",
"protein_id": "ENSP00000394672.2",
"transcript_support_level": 3,
"aa_start": 17552,
"aa_end": null,
"aa_length": 35991,
"cds_start": 52656,
"cds_end": null,
"cds_length": 107976,
"cdna_start": 53173,
"cdna_end": null,
"cdna_length": 109488,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 362,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.52572_52600delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly17525_Lys17534delinsArgSerGlnAsnArgSerGln",
"transcript": "ENST00000425332.3",
"protein_id": "ENSP00000396805.3",
"transcript_support_level": 5,
"aa_start": 17524,
"aa_end": null,
"aa_length": 35963,
"cds_start": 52572,
"cds_end": null,
"cds_length": 107892,
"cdna_start": 52825,
"cdna_end": null,
"cdna_length": 109140,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 360,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.52242_52270delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly17415_Lys17424delinsArgSerGlnAsnArgSerGln",
"transcript": "ENST00000715174.1",
"protein_id": "ENSP00000520370.1",
"transcript_support_level": null,
"aa_start": 17414,
"aa_end": null,
"aa_length": 35853,
"cds_start": 52242,
"cds_end": null,
"cds_length": 107562,
"cdna_start": 52495,
"cdna_end": null,
"cdna_length": 108810,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 313,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.47733_47761delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly15912_Lys15921delinsArgSerGlnAsnArgSerGln",
"transcript": "NM_001256850.1",
"protein_id": "NP_001243779.1",
"transcript_support_level": null,
"aa_start": 15911,
"aa_end": null,
"aa_length": 34350,
"cds_start": 47733,
"cds_end": null,
"cds_length": 103053,
"cdna_start": 47986,
"cdna_end": null,
"cdna_length": 104301,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 313,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.47733_47761delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly15912_Lys15921delinsArgSerGlnAsnArgSerGln",
"transcript": "ENST00000591111.5",
"protein_id": "ENSP00000465570.1",
"transcript_support_level": 5,
"aa_start": 15911,
"aa_end": null,
"aa_length": 34350,
"cds_start": 47733,
"cds_end": null,
"cds_length": 103053,
"cdna_start": 47986,
"cdna_end": null,
"cdna_length": 104301,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 312,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.44952_44980delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly14985_Lys14994delinsArgSerGlnAsnArgSerGln",
"transcript": "NM_133378.4",
"protein_id": "NP_596869.4",
"transcript_support_level": null,
"aa_start": 14984,
"aa_end": null,
"aa_length": 33423,
"cds_start": 44952,
"cds_end": null,
"cds_length": 100272,
"cdna_start": 45205,
"cdna_end": null,
"cdna_length": 101520,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 312,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.44952_44980delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly14985_Lys14994delinsArgSerGlnAsnArgSerGln",
"transcript": "ENST00000342992.11",
"protein_id": "ENSP00000343764.6",
"transcript_support_level": 5,
"aa_start": 14984,
"aa_end": null,
"aa_length": 33423,
"cds_start": 44952,
"cds_end": null,
"cds_length": 100272,
"cdna_start": 45205,
"cdna_end": null,
"cdna_length": 101520,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 192,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.26037_26065delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly8680_Lys8689delinsArgSerGlnAsnArgSerGln",
"transcript": "NM_133437.4",
"protein_id": "NP_597681.4",
"transcript_support_level": null,
"aa_start": 8679,
"aa_end": null,
"aa_length": 27118,
"cds_start": 26037,
"cds_end": null,
"cds_length": 81357,
"cdna_start": 26290,
"cdna_end": null,
"cdna_length": 82605,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 191,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.26037_26065delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly8680_Lys8689delinsArgSerGlnAsnArgSerGln",
"transcript": "ENST00000342175.12",
"protein_id": "ENSP00000340554.6",
"transcript_support_level": 5,
"aa_start": 8679,
"aa_end": null,
"aa_length": 27118,
"cds_start": 26037,
"cds_end": null,
"cds_length": 81357,
"cdna_start": 26065,
"cdna_end": null,
"cdna_length": 82380,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 192,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.25836_25864delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly8613_Lys8622delinsArgSerGlnAsnArgSerGln",
"transcript": "NM_133432.3",
"protein_id": "NP_597676.3",
"transcript_support_level": null,
"aa_start": 8612,
"aa_end": null,
"aa_length": 27051,
"cds_start": 25836,
"cds_end": null,
"cds_length": 81156,
"cdna_start": 26089,
"cdna_end": null,
"cdna_length": 82404,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 191,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.25836_25864delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly8613_Lys8622delinsArgSerGlnAsnArgSerGln",
"transcript": "ENST00000359218.11",
"protein_id": "ENSP00000352154.5",
"transcript_support_level": 5,
"aa_start": 8612,
"aa_end": null,
"aa_length": 27051,
"cds_start": 25836,
"cds_end": null,
"cds_length": 81156,
"cdna_start": 25864,
"cdna_end": null,
"cdna_length": 82179,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 191,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.25461_25489delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly8488_Lys8497delinsArgSerGlnAsnArgSerGln",
"transcript": "NM_003319.4",
"protein_id": "NP_003310.4",
"transcript_support_level": null,
"aa_start": 8487,
"aa_end": null,
"aa_length": 26926,
"cds_start": 25461,
"cds_end": null,
"cds_length": 80781,
"cdna_start": 25714,
"cdna_end": null,
"cdna_length": 82029,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 191,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.25461_25489delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly8488_Lys8497delinsArgSerGlnAsnArgSerGln",
"transcript": "ENST00000460472.6",
"protein_id": "ENSP00000434586.1",
"transcript_support_level": 5,
"aa_start": 8487,
"aa_end": null,
"aa_length": 26926,
"cds_start": 25461,
"cds_end": null,
"cds_length": 80781,
"cdna_start": 25714,
"cdna_end": null,
"cdna_length": 82029,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 359,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.51549_51577delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly17184_Lys17193delinsArgSerGlnAsnArgSerGln",
"transcript": "XM_017004819.1",
"protein_id": "XP_016860308.1",
"transcript_support_level": null,
"aa_start": 17183,
"aa_end": null,
"aa_length": 35622,
"cds_start": 51549,
"cds_end": null,
"cds_length": 106869,
"cdna_start": 51802,
"cdna_end": null,
"cdna_length": 108117,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 317,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.47661_47689delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly15888_Lys15897delinsArgSerGlnAsnArgSerGln",
"transcript": "XM_047445660.1",
"protein_id": "XP_047301616.1",
"transcript_support_level": null,
"aa_start": 15887,
"aa_end": null,
"aa_length": 34326,
"cds_start": 47661,
"cds_end": null,
"cds_length": 102981,
"cdna_start": 47914,
"cdna_end": null,
"cdna_length": 104229,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 313,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.47325_47353delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly15776_Lys15785delinsArgSerGlnAsnArgSerGln",
"transcript": "XM_047445661.1",
"protein_id": "XP_047301617.1",
"transcript_support_level": null,
"aa_start": 15775,
"aa_end": null,
"aa_length": 34214,
"cds_start": 47325,
"cds_end": null,
"cds_length": 102645,
"cdna_start": 47578,
"cdna_end": null,
"cdna_length": 103893,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 310,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.47094_47122delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly15699_Lys15708delinsArgSerGlnAsnArgSerGln",
"transcript": "XM_024453095.1",
"protein_id": "XP_024308863.1",
"transcript_support_level": null,
"aa_start": 15698,
"aa_end": null,
"aa_length": 34137,
"cds_start": 47094,
"cds_end": null,
"cds_length": 102414,
"cdna_start": 47347,
"cdna_end": null,
"cdna_length": 103662,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 336,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.46947_46975delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly15650_Lys15659delinsArgSerGlnAsnArgSerGln",
"transcript": "XM_017004820.1",
"protein_id": "XP_016860309.1",
"transcript_support_level": null,
"aa_start": 15649,
"aa_end": null,
"aa_length": 34088,
"cds_start": 46947,
"cds_end": null,
"cds_length": 102267,
"cdna_start": 47200,
"cdna_end": null,
"cdna_length": 103515,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 336,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.46944_46972delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly15649_Lys15658delinsArgSerGlnAsnArgSerGln",
"transcript": "XM_017004821.1",
"protein_id": "XP_016860310.1",
"transcript_support_level": null,
"aa_start": 15648,
"aa_end": null,
"aa_length": 34087,
"cds_start": 46944,
"cds_end": null,
"cds_length": 102264,
"cdna_start": 47197,
"cdna_end": null,
"cdna_length": 103512,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 300,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.46200_46228delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly15401_Lys15410delinsArgSerGlnAsnArgSerGln",
"transcript": "XM_047445663.1",
"protein_id": "XP_047301619.1",
"transcript_support_level": null,
"aa_start": 15400,
"aa_end": null,
"aa_length": 33839,
"cds_start": 46200,
"cds_end": null,
"cds_length": 101520,
"cdna_start": 46453,
"cdna_end": null,
"cdna_length": 102768,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 282,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.44640_44668delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly14881_Lys14890delinsArgSerGlnAsnArgSerGln",
"transcript": "XM_047445665.1",
"protein_id": "XP_047301621.1",
"transcript_support_level": null,
"aa_start": 14880,
"aa_end": null,
"aa_length": 33319,
"cds_start": 44640,
"cds_end": null,
"cds_length": 99960,
"cdna_start": 44893,
"cdna_end": null,
"cdna_length": 101208,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 277,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.44217_44245delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly14740_Lys14749delinsArgSerGlnAsnArgSerGln",
"transcript": "XM_047445668.1",
"protein_id": "XP_047301624.1",
"transcript_support_level": null,
"aa_start": 14739,
"aa_end": null,
"aa_length": 33178,
"cds_start": 44217,
"cds_end": null,
"cds_length": 99537,
"cdna_start": 44470,
"cdna_end": null,
"cdna_length": 100785,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 274,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.43986_44014delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly14663_Lys14672delinsArgSerGlnAsnArgSerGln",
"transcript": "XM_017004822.1",
"protein_id": "XP_016860311.1",
"transcript_support_level": null,
"aa_start": 14662,
"aa_end": null,
"aa_length": 33101,
"cds_start": 43986,
"cds_end": null,
"cds_length": 99306,
"cdna_start": 44239,
"cdna_end": null,
"cdna_length": 100554,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 273,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.43869_43897delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly14624_Lys14633delinsArgSerGlnAsnArgSerGln",
"transcript": "XM_024453097.1",
"protein_id": "XP_024308865.1",
"transcript_support_level": null,
"aa_start": 14623,
"aa_end": null,
"aa_length": 33062,
"cds_start": 43869,
"cds_end": null,
"cds_length": 99189,
"cdna_start": 44122,
"cdna_end": null,
"cdna_length": 100437,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 272,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.43788_43816delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly14597_Lys14606delinsArgSerGlnAsnArgSerGln",
"transcript": "XM_024453098.1",
"protein_id": "XP_024308866.1",
"transcript_support_level": null,
"aa_start": 14596,
"aa_end": null,
"aa_length": 33035,
"cds_start": 43788,
"cds_end": null,
"cds_length": 99108,
"cdna_start": 44041,
"cdna_end": null,
"cdna_length": 100356,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 192,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.25602_25630delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly8535_Lys8544delinsArgSerGlnAsnArgSerGln",
"transcript": "XM_017004823.1",
"protein_id": "XP_016860312.1",
"transcript_support_level": null,
"aa_start": 8534,
"aa_end": null,
"aa_length": 26973,
"cds_start": 25602,
"cds_end": null,
"cds_length": 80922,
"cdna_start": 25855,
"cdna_end": null,
"cdna_length": 82170,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 191,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.25551_25579delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly8518_Lys8527delinsArgSerGlnAsnArgSerGln",
"transcript": "XM_024453099.1",
"protein_id": "XP_024308867.1",
"transcript_support_level": null,
"aa_start": 8517,
"aa_end": null,
"aa_length": 26956,
"cds_start": 25551,
"cds_end": null,
"cds_length": 80871,
"cdna_start": 25804,
"cdna_end": null,
"cdna_length": 82119,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "PGKFSPPSDPK",
"aa_alt": "PRSQNRSQ",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"missense_variant",
"disruptive_inframe_deletion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 184,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.15405_15433delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly5136_Lys5145delinsArgSerGlnAsnArgSerGln",
"transcript": "XM_024453100.2",
"protein_id": "XP_024308868.1",
"transcript_support_level": null,
"aa_start": 5135,
"aa_end": null,
"aa_length": 23574,
"cds_start": 15405,
"cds_end": null,
"cds_length": 70725,
"cdna_start": 15597,
"cdna_end": null,
"cdna_length": 71912,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.682_710delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000456053.5",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2033,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.554_582delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000610290.4",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 647,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.-3_26delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000627527.1",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 784,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.715_743delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "NR_038271.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2069,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.198+84563_198+84591delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000585451.5",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 949,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.511-5836_511-5808delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000589234.5",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 751,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.110+7532_110+7560delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000589487.5",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1077,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.86+10518_86+10546delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000589830.1",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 287,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.506+10518_506+10546delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000589907.5",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 568,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.683+10518_683+10546delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000590773.6",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2377,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.395+7532_395+7560delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000590807.5",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 728,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.962+7532_962+7560delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000592600.6",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1748,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.519+10518_519+10546delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000592630.5",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 666,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.432-7124_432-7096delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000592750.5",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 619,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.135+10518_135+10546delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000625480.2",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 633,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.393+7532_393+7560delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000625536.2",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 693,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.336+10518_336+10546delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000626117.2",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 572,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.246-7124_246-7096delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000626138.2",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 693,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.160+10518_160+10546delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000626954.2",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 864,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.421+7532_421+7560delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000628296.2",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 483,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.50-28375_50-28347delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000628826.2",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 662,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.904+7532_904+7560delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000630096.2",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 915,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.415+7532_415+7560delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000653807.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3996,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.314+7532_314+7560delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000657023.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2491,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.502+10518_502+10546delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000659121.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6297,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.1421+7532_1421+7560delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000671355.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2244,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.516+10518_516+10546delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000702938.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1012,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.710+10518_710+10546delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000768381.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1203,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.626+7532_626+7560delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000768382.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 686,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.510+10518_510+10546delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000768383.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 570,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.686+10518_686+10546delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000768384.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 741,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.-3_26delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null,
"transcript": "ENST00000627527.1",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 784,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"dbsnp": "rs727503613",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 9.94,
"phylop100way_prediction": "Pathogenic",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 5,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "PM2,PM4,PP3",
"acmg_by_gene": [
{
"score": 5,
"benign_score": 0,
"pathogenic_score": 5,
"criteria": [
"PM2",
"PM4",
"PP3"
],
"verdict": "Uncertain_significance",
"transcript": "ENST00000589042.5",
"gene_symbol": "TTN",
"hgnc_id": 12403,
"effects": [
"missense_variant",
"disruptive_inframe_deletion"
],
"inheritance_mode": "AD,AR",
"hgvs_c": "c.52656_52684delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC",
"hgvs_p": "p.Gly17553_Lys17562delinsArgSerGlnAsnArgSerGln"
},
{
"score": 3,
"benign_score": 0,
"pathogenic_score": 3,
"criteria": [
"PM2",
"PP3"
],
"verdict": "Uncertain_significance",
"transcript": "ENST00000456053.5",
"gene_symbol": "TTN-AS1",
"hgnc_id": 44124,
"effects": [
"non_coding_transcript_exon_variant"
],
"inheritance_mode": "",
"hgvs_c": "n.682_710delTGGGATCTGAAGGTGGACTGAACTTTCCAinsGGGATCTGTTTTGGGATCTG",
"hgvs_p": null
}
],
"clinvar_disease": "not specified",
"clinvar_classification": "Uncertain significance",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "US:1",
"phenotype_combined": "not specified",
"pathogenicity_classification_combined": "Uncertain significance",
"custom_annotations": null
}
],
"message": null
}