← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 2-19941836-GTTCCTTTAAAGACAAAAAAAAAGTTATGTTTCA-G (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=2&pos=19941836&ref=GTTCCTTTAAAGACAAAAAAAAAGTTATGTTTCA&alt=G&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "2",
      "pos": 19941836,
      "ref": "GTTCCTTTAAAGACAAAAAAAAAGTTATGTTTCA",
      "alt": "G",
      "effect": "splice_acceptor_variant,conservative_inframe_deletion,splice_region_variant,intron_variant",
      "transcript": "ENST00000281405.9",
      "consequences": [
        {
          "aa_ref": "EE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_acceptor_variant",
            "conservative_inframe_deletion",
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": 18,
          "exon_rank_end": null,
          "exon_count": 28,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "WDR35",
          "gene_hgnc_id": 29250,
          "hgvs_c": "c.1879-30_1881delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA",
          "hgvs_p": "p.Glu627_Pro628del",
          "transcript": "NM_001006657.2",
          "protein_id": "NP_001006658.1",
          "transcript_support_level": null,
          "aa_start": 627,
          "aa_end": null,
          "aa_length": 1181,
          "cds_start": 1879,
          "cds_end": null,
          "cds_length": 3546,
          "cdna_start": 1971,
          "cdna_end": null,
          "cdna_length": 6931,
          "mane_select": null,
          "mane_plus": "ENST00000345530.8",
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_acceptor_variant",
            "conservative_inframe_deletion",
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": 18,
          "exon_rank_end": null,
          "exon_count": 28,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "WDR35",
          "gene_hgnc_id": 29250,
          "hgvs_c": "c.1879-30_1881delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA",
          "hgvs_p": "p.Glu627_Pro628del",
          "transcript": "ENST00000345530.8",
          "protein_id": "ENSP00000314444.5",
          "transcript_support_level": 1,
          "aa_start": 627,
          "aa_end": null,
          "aa_length": 1181,
          "cds_start": 1879,
          "cds_end": null,
          "cds_length": 3546,
          "cdna_start": 1971,
          "cdna_end": null,
          "cdna_length": 6931,
          "mane_select": null,
          "mane_plus": "NM_001006657.2",
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_acceptor_variant",
            "conservative_inframe_deletion",
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 27,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "WDR35",
          "gene_hgnc_id": 29250,
          "hgvs_c": "c.1846-30_1848delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA",
          "hgvs_p": "p.Glu616_Pro617del",
          "transcript": "NM_020779.4",
          "protein_id": "NP_065830.2",
          "transcript_support_level": null,
          "aa_start": 616,
          "aa_end": null,
          "aa_length": 1170,
          "cds_start": 1846,
          "cds_end": null,
          "cds_length": 3513,
          "cdna_start": 1938,
          "cdna_end": null,
          "cdna_length": 6898,
          "mane_select": "ENST00000281405.9",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EE",
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_acceptor_variant",
            "conservative_inframe_deletion",
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 27,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "WDR35",
          "gene_hgnc_id": 29250,
          "hgvs_c": "c.1846-30_1848delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA",
          "hgvs_p": "p.Glu616_Pro617del",
          "transcript": "ENST00000281405.9",
          "protein_id": "ENSP00000281405.5",
          "transcript_support_level": 1,
          "aa_start": 616,
          "aa_end": null,
          "aa_length": 1170,
          "cds_start": 1846,
          "cds_end": null,
          "cds_length": 3513,
          "cdna_start": 1938,
          "cdna_end": null,
          "cdna_length": 6898,
          "mane_select": "NM_020779.4",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_acceptor_variant",
            "conservative_inframe_deletion",
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "WDR35",
          "gene_hgnc_id": 29250,
          "hgvs_c": "c.484-30_486delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA",
          "hgvs_p": "p.Glu162_Pro163del",
          "transcript": "ENST00000453014.1",
          "protein_id": "ENSP00000404409.1",
          "transcript_support_level": 1,
          "aa_start": 162,
          "aa_end": null,
          "aa_length": 406,
          "cds_start": 484,
          "cds_end": null,
          "cds_length": 1221,
          "cdna_start": 486,
          "cdna_end": null,
          "cdna_length": 1624,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "splice_region_variant",
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 18,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "WDR35",
          "gene_hgnc_id": 29250,
          "hgvs_c": "n.*570-30_*572delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA",
          "hgvs_p": null,
          "transcript": "ENST00000445063.5",
          "protein_id": "ENSP00000390105.1",
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2788,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "splice_acceptor_variant",
            "splice_region_variant",
            "intron_variant",
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 18,
          "exon_rank_end": null,
          "exon_count": 28,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "WDR35",
          "gene_hgnc_id": 29250,
          "hgvs_c": "n.1879-30_1881delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA",
          "hgvs_p": null,
          "transcript": "ENST00000414212.5",
          "protein_id": "ENSP00000390802.1",
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3483,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "splice_acceptor_variant",
            "splice_region_variant",
            "3_prime_UTR_variant",
            "intron_variant"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 18,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "WDR35",
          "gene_hgnc_id": 29250,
          "hgvs_c": "n.*570-30_*572delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA",
          "hgvs_p": null,
          "transcript": "ENST00000445063.5",
          "protein_id": "ENSP00000390105.1",
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2788,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_acceptor_variant",
            "conservative_inframe_deletion",
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "WDR35",
          "gene_hgnc_id": 29250,
          "hgvs_c": "c.574-30_576delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA",
          "hgvs_p": "p.Glu192_Pro193del",
          "transcript": "XM_011533007.3",
          "protein_id": "XP_011531309.1",
          "transcript_support_level": null,
          "aa_start": 192,
          "aa_end": null,
          "aa_length": 746,
          "cds_start": 574,
          "cds_end": null,
          "cds_length": 2241,
          "cdna_start": 681,
          "cdna_end": null,
          "cdna_length": 5641,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_acceptor_variant",
            "conservative_inframe_deletion",
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 19,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "WDR35",
          "gene_hgnc_id": 29250,
          "hgvs_c": "c.1846-30_1848delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA",
          "hgvs_p": "p.Glu616_Pro617del",
          "transcript": "XM_047445199.1",
          "protein_id": "XP_047301155.1",
          "transcript_support_level": null,
          "aa_start": 616,
          "aa_end": null,
          "aa_length": 673,
          "cds_start": 1846,
          "cds_end": null,
          "cds_length": 2022,
          "cdna_start": 1938,
          "cdna_end": null,
          "cdna_length": 2216,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "splice_acceptor_variant",
            "splice_region_variant",
            "intron_variant",
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 17,
          "exon_rank_end": null,
          "exon_count": 25,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "WDR35",
          "gene_hgnc_id": 29250,
          "hgvs_c": "n.1936-30_1938delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA",
          "hgvs_p": null,
          "transcript": "XR_426989.4",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3061,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 18,
          "intron_rank": 16,
          "intron_rank_end": null,
          "gene_symbol": "WDR35",
          "gene_hgnc_id": 29250,
          "hgvs_c": "n.1936-144_1936-112delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA",
          "hgvs_p": null,
          "transcript": "XR_939699.4",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2122,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "WDR35",
      "gene_hgnc_id": 29250,
      "dbsnp": "rs1553317813",
      "frequency_reference_population": 7.0635537e-7,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 1,
      "gnomad_exomes_af": 7.06355e-7,
      "gnomad_genomes_af": null,
      "gnomad_exomes_ac": 1,
      "gnomad_genomes_ac": null,
      "gnomad_exomes_homalt": 0,
      "gnomad_genomes_homalt": null,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 7.732,
      "phylop100way_prediction": "Pathogenic",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 4,
      "acmg_classification": "Uncertain_significance",
      "acmg_criteria": "PVS1_Moderate,PP5_Moderate",
      "acmg_by_gene": [
        {
          "score": 4,
          "benign_score": 0,
          "pathogenic_score": 4,
          "criteria": [
            "PVS1_Moderate",
            "PP5_Moderate"
          ],
          "verdict": "Uncertain_significance",
          "transcript": "ENST00000281405.9",
          "gene_symbol": "WDR35",
          "hgnc_id": 29250,
          "effects": [
            "splice_acceptor_variant",
            "conservative_inframe_deletion",
            "splice_region_variant",
            "intron_variant"
          ],
          "inheritance_mode": "AR",
          "hgvs_c": "c.1846-30_1848delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA",
          "hgvs_p": "p.Glu616_Pro617del"
        }
      ],
      "clinvar_disease": "Cranioectodermal dysplasia 2,Short-rib thoracic dysplasia 7 with or without polydactyly",
      "clinvar_classification": "Likely pathogenic",
      "clinvar_review_status": "criteria provided, single submitter",
      "clinvar_submissions_summary": "LP:1",
      "phenotype_combined": "Short-rib thoracic dysplasia 7 with or without polydactyly;Cranioectodermal dysplasia 2",
      "pathogenicity_classification_combined": "Likely pathogenic",
      "custom_annotations": null
    }
  ],
  "message": null
}