← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 2-73385903-T-TGGAGGAGGAGGAGGAGGAGGAGGA (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=2&pos=73385903&ref=T&alt=TGGAGGAGGAGGAGGAGGAGGAGGA&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "2",
"pos": 73385903,
"ref": "T",
"alt": "TGGAGGAGGAGGAGGAGGAGGAGGA",
"effect": "disruptive_inframe_insertion",
"transcript": "ENST00000613296.6",
"consequences": [
{
"aa_ref": "E",
"aa_alt": "EEEEEEEEE",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ALMS1",
"gene_hgnc_id": 428,
"hgvs_c": "c.51_74dupGGAGGAGGAGGAGGAGGAGGAGGA",
"hgvs_p": "p.Glu18_Glu25dup",
"transcript": "NM_001378454.1",
"protein_id": "NP_001365383.1",
"transcript_support_level": null,
"aa_start": 25,
"aa_end": null,
"aa_length": 4168,
"cds_start": 75,
"cds_end": null,
"cds_length": 12507,
"cdna_start": 108,
"cdna_end": null,
"cdna_length": 12844,
"mane_select": "ENST00000613296.6",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "EEEEEEEEE",
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ALMS1",
"gene_hgnc_id": 428,
"hgvs_c": "c.51_74dupGGAGGAGGAGGAGGAGGAGGAGGA",
"hgvs_p": "p.Glu18_Glu25dup",
"transcript": "ENST00000613296.6",
"protein_id": "ENSP00000482968.1",
"transcript_support_level": 1,
"aa_start": 25,
"aa_end": null,
"aa_length": 4168,
"cds_start": 75,
"cds_end": null,
"cds_length": 12507,
"cdna_start": 108,
"cdna_end": null,
"cdna_length": 12844,
"mane_select": "NM_001378454.1",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "EEEEEEEEE",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ALMS1",
"gene_hgnc_id": 428,
"hgvs_c": "c.51_74dupGGAGGAGGAGGAGGAGGAGGAGGA",
"hgvs_p": "p.Glu18_Glu25dup",
"transcript": "ENST00000484298.5",
"protein_id": "ENSP00000478155.1",
"transcript_support_level": 1,
"aa_start": 25,
"aa_end": null,
"aa_length": 4126,
"cds_start": 75,
"cds_end": null,
"cds_length": 12381,
"cdna_start": 186,
"cdna_end": null,
"cdna_length": 12595,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "EEEEEEEEE",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ALMS1",
"gene_hgnc_id": 428,
"hgvs_c": "c.51_74dupGGAGGAGGAGGAGGAGGAGGAGGA",
"hgvs_p": "p.Glu18_Glu25dup",
"transcript": "NM_015120.4",
"protein_id": "NP_055935.4",
"transcript_support_level": null,
"aa_start": 25,
"aa_end": null,
"aa_length": 4168,
"cds_start": 75,
"cds_end": null,
"cds_length": 12507,
"cdna_start": 186,
"cdna_end": null,
"cdna_length": 12925,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "EEEEEEEEE",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ALMS1",
"gene_hgnc_id": 428,
"hgvs_c": "c.51_74dupGGAGGAGGAGGAGGAGGAGGAGGA",
"hgvs_p": "p.Glu18_Glu25dup",
"transcript": "ENST00000614410.4",
"protein_id": "ENSP00000479094.1",
"transcript_support_level": 5,
"aa_start": 25,
"aa_end": null,
"aa_length": 3859,
"cds_start": 75,
"cds_end": null,
"cds_length": 11580,
"cdna_start": 75,
"cdna_end": null,
"cdna_length": 11700,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ALMS1",
"gene_hgnc_id": 428,
"hgvs_c": "n.11_34dupGGAGGAGGAGGAGGAGGAGGAGGA",
"hgvs_p": null,
"transcript": "ENST00000682675.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1268,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ALMS1",
"gene_hgnc_id": 428,
"hgvs_c": "n.16_39dupGGAGGAGGAGGAGGAGGAGGAGGA",
"hgvs_p": null,
"transcript": "ENST00000682889.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1570,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ENSG00000285068",
"gene_hgnc_id": null,
"hgvs_c": "n.-236_-213dupTCCTCCTCCTCCTCCTCCTCCTCC",
"hgvs_p": null,
"transcript": "ENST00000646469.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 659,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ALMS1",
"gene_hgnc_id": 428,
"hgvs_c": "n.-6_-5insGGAGGAGGAGGAGGAGGAGGAGGA",
"hgvs_p": null,
"transcript": "ENST00000682675.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1268,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ALMS1",
"gene_hgnc_id": 428,
"hgvs_c": "n.-94_-93insGGAGGAGGAGGAGGAGGAGGAGGA",
"hgvs_p": null,
"transcript": "ENST00000684148.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3775,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ENSG00000285068",
"gene_hgnc_id": null,
"hgvs_c": "n.-236_-213dupTCCTCCTCCTCCTCCTCCTCCTCC",
"hgvs_p": null,
"transcript": "ENST00000722686.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 625,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ENSG00000285068",
"gene_hgnc_id": null,
"hgvs_c": "n.-241_-218dupTCCTCCTCCTCCTCCTCCTCCTCC",
"hgvs_p": null,
"transcript": "ENST00000722687.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 718,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ENSG00000285068",
"gene_hgnc_id": null,
"hgvs_c": "n.-261_-238dupTCCTCCTCCTCCTCCTCCTCCTCC",
"hgvs_p": null,
"transcript": "ENST00000722688.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 863,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LOC105374804",
"gene_hgnc_id": null,
"hgvs_c": "n.-246_-223dupTCCTCCTCCTCCTCCTCCTCCTCC",
"hgvs_p": null,
"transcript": "XR_007087045.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 900,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LOC105374804",
"gene_hgnc_id": null,
"hgvs_c": "n.-246_-223dupTCCTCCTCCTCCTCCTCCTCCTCC",
"hgvs_p": null,
"transcript": "XR_007087053.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 942,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "ALMS1",
"gene_hgnc_id": 428,
"dbsnp": "rs55889738",
"frequency_reference_population": 0.00005132782,
"hom_count_reference_population": 0,
"allele_count_reference_population": 36,
"gnomad_exomes_af": 0.0000573746,
"gnomad_genomes_af": 0.0000278482,
"gnomad_exomes_ac": 32,
"gnomad_genomes_ac": 4,
"gnomad_exomes_homalt": 0,
"gnomad_genomes_homalt": 0,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 0.369,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": -2,
"acmg_classification": "Likely_benign",
"acmg_criteria": "BP3,BP6",
"acmg_by_gene": [
{
"score": -2,
"benign_score": 2,
"pathogenic_score": 0,
"criteria": [
"BP3",
"BP6"
],
"verdict": "Likely_benign",
"transcript": "ENST00000613296.6",
"gene_symbol": "ALMS1",
"hgnc_id": 428,
"effects": [
"disruptive_inframe_insertion"
],
"inheritance_mode": "AR",
"hgvs_c": "c.51_74dupGGAGGAGGAGGAGGAGGAGGAGGA",
"hgvs_p": "p.Glu18_Glu25dup"
},
{
"score": -1,
"benign_score": 1,
"pathogenic_score": 0,
"criteria": [
"BP6"
],
"verdict": "Likely_benign",
"transcript": "ENST00000646469.2",
"gene_symbol": "ENSG00000285068",
"hgnc_id": null,
"effects": [
"upstream_gene_variant"
],
"inheritance_mode": "",
"hgvs_c": "n.-236_-213dupTCCTCCTCCTCCTCCTCCTCCTCC",
"hgvs_p": null
},
{
"score": -1,
"benign_score": 1,
"pathogenic_score": 0,
"criteria": [
"BP6"
],
"verdict": "Likely_benign",
"transcript": "XR_007087045.1",
"gene_symbol": "LOC105374804",
"hgnc_id": null,
"effects": [
"upstream_gene_variant"
],
"inheritance_mode": "",
"hgvs_c": "n.-246_-223dupTCCTCCTCCTCCTCCTCCTCCTCC",
"hgvs_p": null
}
],
"clinvar_disease": "ALMS1-related disorder,Alstrom syndrome,not specified",
"clinvar_classification": "Conflicting classifications of pathogenicity",
"clinvar_review_status": "criteria provided, conflicting classifications",
"clinvar_submissions_summary": "US:2 LB:1",
"phenotype_combined": "not specified|ALMS1-related disorder|Alstrom syndrome",
"pathogenicity_classification_combined": "Conflicting classifications of pathogenicity",
"custom_annotations": null
}
],
"message": null
}