← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 21-44331921-TTGGGGCCGCCGTGGCCTGTGCCCTCTCTCTC-T (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=21&pos=44331921&ref=TTGGGGCCGCCGTGGCCTGTGCCCTCTCTCTC&alt=T&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "21",
"pos": 44331921,
"ref": "TTGGGGCCGCCGTGGCCTGTGCCCTCTCTCTC",
"alt": "T",
"effect": "frameshift_variant",
"transcript": "NM_001271441.2",
"consequences": [
{
"aa_ref": "EREGTGHGGPK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CFAP410",
"gene_hgnc_id": 1260,
"hgvs_c": "c.436_466delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA",
"hgvs_p": "p.Glu146fs",
"transcript": "NM_004928.3",
"protein_id": "NP_004919.1",
"transcript_support_level": null,
"aa_start": 146,
"aa_end": null,
"aa_length": 256,
"cds_start": 436,
"cds_end": null,
"cds_length": 771,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": "ENST00000339818.9",
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_004928.3"
},
{
"aa_ref": "EREGTGHGGPK",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CFAP410",
"gene_hgnc_id": 1260,
"hgvs_c": "c.436_466delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA",
"hgvs_p": "p.Glu146fs",
"transcript": "ENST00000339818.9",
"protein_id": "ENSP00000344566.4",
"transcript_support_level": 1,
"aa_start": 146,
"aa_end": null,
"aa_length": 256,
"cds_start": 436,
"cds_end": null,
"cds_length": 771,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": "NM_004928.3",
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000339818.9"
},
{
"aa_ref": "EREGTGHGGPK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CFAP410",
"gene_hgnc_id": 1260,
"hgvs_c": "c.436_466delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA",
"hgvs_p": "p.Glu146fs",
"transcript": "ENST00000397956.7",
"protein_id": "ENSP00000381047.3",
"transcript_support_level": 1,
"aa_start": 146,
"aa_end": null,
"aa_length": 375,
"cds_start": 436,
"cds_end": null,
"cds_length": 1128,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000397956.7"
},
{
"aa_ref": "EREGTGHGGPK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CFAP410",
"gene_hgnc_id": 1260,
"hgvs_c": "c.436_466delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA",
"hgvs_p": "p.Glu146fs",
"transcript": "ENST00000325223.7",
"protein_id": "ENSP00000317302.7",
"transcript_support_level": 1,
"aa_start": 146,
"aa_end": null,
"aa_length": 255,
"cds_start": 436,
"cds_end": null,
"cds_length": 768,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000325223.7"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CFAP410",
"gene_hgnc_id": 1260,
"hgvs_c": "n.552_582delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA",
"hgvs_p": null,
"transcript": "ENST00000496321.5",
"protein_id": null,
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "ENST00000496321.5"
},
{
"aa_ref": "EREGTGHGGPK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CFAP410",
"gene_hgnc_id": 1260,
"hgvs_c": "c.436_466delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA",
"hgvs_p": "p.Glu146fs",
"transcript": "NM_001271441.2",
"protein_id": "NP_001258370.1",
"transcript_support_level": null,
"aa_start": 146,
"aa_end": null,
"aa_length": 375,
"cds_start": 436,
"cds_end": null,
"cds_length": 1128,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001271441.2"
},
{
"aa_ref": "EREGTGHGGPK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CFAP410",
"gene_hgnc_id": 1260,
"hgvs_c": "c.436_466delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA",
"hgvs_p": "p.Glu146fs",
"transcript": "NM_001271440.2",
"protein_id": "NP_001258369.1",
"transcript_support_level": null,
"aa_start": 146,
"aa_end": null,
"aa_length": 255,
"cds_start": 436,
"cds_end": null,
"cds_length": 768,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001271440.2"
},
{
"aa_ref": "EREGTGHGGPK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CFAP410",
"gene_hgnc_id": 1260,
"hgvs_c": "c.313_343delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA",
"hgvs_p": "p.Glu105fs",
"transcript": "NM_001271442.1",
"protein_id": "NP_001258371.1",
"transcript_support_level": null,
"aa_start": 105,
"aa_end": null,
"aa_length": 214,
"cds_start": 313,
"cds_end": null,
"cds_length": 645,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001271442.1"
},
{
"aa_ref": "EREGTGHGGPK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CFAP410",
"gene_hgnc_id": 1260,
"hgvs_c": "c.511_541delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA",
"hgvs_p": "p.Glu171fs",
"transcript": "XM_047440980.1",
"protein_id": "XP_047296936.1",
"transcript_support_level": null,
"aa_start": 171,
"aa_end": null,
"aa_length": 401,
"cds_start": 511,
"cds_end": null,
"cds_length": 1206,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047440980.1"
},
{
"aa_ref": "EREGTGHGGPK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CFAP410",
"gene_hgnc_id": 1260,
"hgvs_c": "c.511_541delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA",
"hgvs_p": "p.Glu171fs",
"transcript": "XM_047440981.1",
"protein_id": "XP_047296937.1",
"transcript_support_level": null,
"aa_start": 171,
"aa_end": null,
"aa_length": 400,
"cds_start": 511,
"cds_end": null,
"cds_length": 1203,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047440981.1"
},
{
"aa_ref": "EREGTGHGGPK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CFAP410",
"gene_hgnc_id": 1260,
"hgvs_c": "c.436_466delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA",
"hgvs_p": "p.Glu146fs",
"transcript": "XM_047440982.1",
"protein_id": "XP_047296938.1",
"transcript_support_level": null,
"aa_start": 146,
"aa_end": null,
"aa_length": 376,
"cds_start": 436,
"cds_end": null,
"cds_length": 1131,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047440982.1"
},
{
"aa_ref": "EREGTGHGGPK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CFAP410",
"gene_hgnc_id": 1260,
"hgvs_c": "c.511_541delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA",
"hgvs_p": "p.Glu171fs",
"transcript": "XM_006724051.4",
"protein_id": "XP_006724114.1",
"transcript_support_level": null,
"aa_start": 171,
"aa_end": null,
"aa_length": 281,
"cds_start": 511,
"cds_end": null,
"cds_length": 846,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_006724051.4"
},
{
"aa_ref": "EREGTGHGGPK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CFAP410",
"gene_hgnc_id": 1260,
"hgvs_c": "c.511_541delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA",
"hgvs_p": "p.Glu171fs",
"transcript": "XM_047440983.1",
"protein_id": "XP_047296939.1",
"transcript_support_level": null,
"aa_start": 171,
"aa_end": null,
"aa_length": 280,
"cds_start": 511,
"cds_end": null,
"cds_length": 843,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047440983.1"
},
{
"aa_ref": "EREGTGHGGPK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CFAP410",
"gene_hgnc_id": 1260,
"hgvs_c": "c.112_142delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA",
"hgvs_p": "p.Glu38fs",
"transcript": "XM_047440984.1",
"protein_id": "XP_047296940.1",
"transcript_support_level": null,
"aa_start": 38,
"aa_end": null,
"aa_length": 268,
"cds_start": 112,
"cds_end": null,
"cds_length": 807,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047440984.1"
},
{
"aa_ref": "EREGTGHGGPK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CFAP410",
"gene_hgnc_id": 1260,
"hgvs_c": "c.112_142delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA",
"hgvs_p": "p.Glu38fs",
"transcript": "XM_047440985.1",
"protein_id": "XP_047296941.1",
"transcript_support_level": null,
"aa_start": 38,
"aa_end": null,
"aa_length": 268,
"cds_start": 112,
"cds_end": null,
"cds_length": 807,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047440985.1"
},
{
"aa_ref": "EREGTGHGGPK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CFAP410",
"gene_hgnc_id": 1260,
"hgvs_c": "c.112_142delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA",
"hgvs_p": "p.Glu38fs",
"transcript": "XM_047440986.1",
"protein_id": "XP_047296942.1",
"transcript_support_level": null,
"aa_start": 38,
"aa_end": null,
"aa_length": 268,
"cds_start": 112,
"cds_end": null,
"cds_length": 807,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047440986.1"
},
{
"aa_ref": "EREGTGHGGPK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CFAP410",
"gene_hgnc_id": 1260,
"hgvs_c": "c.112_142delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA",
"hgvs_p": "p.Glu38fs",
"transcript": "XM_047440987.1",
"protein_id": "XP_047296943.1",
"transcript_support_level": null,
"aa_start": 38,
"aa_end": null,
"aa_length": 267,
"cds_start": 112,
"cds_end": null,
"cds_length": 804,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047440987.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ENSG00000184441",
"gene_hgnc_id": null,
"hgvs_c": "n.698_728delCGTGGCCTGTGCCCTCTCTCTCTGGGGCCGC",
"hgvs_p": null,
"transcript": "ENST00000448927.1",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "ENST00000448927.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CFAP410",
"gene_hgnc_id": 1260,
"hgvs_c": "n.2607_2637delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA",
"hgvs_p": null,
"transcript": "ENST00000462742.1",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "retained_intron",
"feature": "ENST00000462742.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CFAP410",
"gene_hgnc_id": 1260,
"hgvs_c": "n.17_47delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA",
"hgvs_p": null,
"transcript": "ENST00000470196.5",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "ENST00000470196.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CFAP410",
"gene_hgnc_id": 1260,
"hgvs_c": "n.*10_*40delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA",
"hgvs_p": null,
"transcript": "ENST00000478674.1",
"protein_id": null,
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "retained_intron",
"feature": "ENST00000478674.1"
}
],
"gene_symbol": "CFAP410",
"gene_hgnc_id": 1260,
"dbsnp": "rs746633371",
"frequency_reference_population": 0.0000034221027,
"hom_count_reference_population": 0,
"allele_count_reference_population": 5,
"gnomad_exomes_af": 0.0000034221,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": 5,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": 0,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 1.533,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 10,
"acmg_classification": "Pathogenic",
"acmg_criteria": "PVS1,PP5_Moderate",
"acmg_by_gene": [
{
"score": 10,
"benign_score": 0,
"pathogenic_score": 10,
"criteria": [
"PVS1",
"PP5_Moderate"
],
"verdict": "Pathogenic",
"transcript": "NM_001271441.2",
"gene_symbol": "CFAP410",
"hgnc_id": 1260,
"effects": [
"frameshift_variant"
],
"inheritance_mode": "AD,AR",
"hgvs_c": "c.436_466delGAGAGAGAGGGCACAGGCCACGGCGGCCCCA",
"hgvs_p": "p.Glu146fs"
},
{
"score": 2,
"benign_score": 0,
"pathogenic_score": 2,
"criteria": [
"PP5_Moderate"
],
"verdict": "Uncertain_significance",
"transcript": "ENST00000448927.1",
"gene_symbol": "ENSG00000184441",
"hgnc_id": null,
"effects": [
"non_coding_transcript_exon_variant"
],
"inheritance_mode": "",
"hgvs_c": "n.698_728delCGTGGCCTGTGCCCTCTCTCTCTGGGGCCGC",
"hgvs_p": null
}
],
"clinvar_disease": "Retinal dystrophy with or without macular staphyloma,not provided",
"clinvar_classification": "Pathogenic",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "P:1",
"phenotype_combined": "Retinal dystrophy with or without macular staphyloma|not provided",
"pathogenicity_classification_combined": "Pathogenic",
"custom_annotations": null
}
],
"message": null
}