← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 22-28725096-GCAATGTAAGAGTTTTTAGGACC-G (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=22&pos=28725096&ref=GCAATGTAAGAGTTTTTAGGACC&alt=G&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "22",
      "pos": 28725096,
      "ref": "GCAATGTAAGAGTTTTTAGGACC",
      "alt": "G",
      "effect": "frameshift_variant",
      "transcript": "ENST00000404276.6",
      "consequences": [
        {
          "aa_ref": "GPKNSYIA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.451_472delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": "p.Gly151fs",
          "transcript": "NM_007194.4",
          "protein_id": "NP_009125.1",
          "transcript_support_level": null,
          "aa_start": 151,
          "aa_end": null,
          "aa_length": 543,
          "cds_start": 451,
          "cds_end": null,
          "cds_length": 1632,
          "cdna_start": 530,
          "cdna_end": null,
          "cdna_length": 1844,
          "mane_select": "ENST00000404276.6",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "GPKNSYIA",
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.451_472delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": "p.Gly151fs",
          "transcript": "ENST00000404276.6",
          "protein_id": "ENSP00000385747.1",
          "transcript_support_level": 1,
          "aa_start": 151,
          "aa_end": null,
          "aa_length": 543,
          "cds_start": 451,
          "cds_end": null,
          "cds_length": 1632,
          "cdna_start": 530,
          "cdna_end": null,
          "cdna_length": 1844,
          "mane_select": "NM_007194.4",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "GPKNSYIA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.580_601delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": "p.Gly194fs",
          "transcript": "ENST00000382580.6",
          "protein_id": "ENSP00000372023.2",
          "transcript_support_level": 1,
          "aa_start": 194,
          "aa_end": null,
          "aa_length": 586,
          "cds_start": 580,
          "cds_end": null,
          "cds_length": 1761,
          "cdna_start": 677,
          "cdna_end": null,
          "cdna_length": 1971,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "n.451_472delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "ENST00000416671.5",
          "protein_id": "ENSP00000402225.1",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2560,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": 2,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.444+125_444+146delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "ENST00000402731.6",
          "protein_id": "ENSP00000384835.2",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 476,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 1431,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1591,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 12,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.320-5633_320-5612delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "ENST00000403642.5",
          "protein_id": "ENSP00000384919.1",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 452,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 1359,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1359,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "GPKNSYIA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.580_601delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": "p.Gly194fs",
          "transcript": "NM_001005735.3",
          "protein_id": "NP_001005735.1",
          "transcript_support_level": null,
          "aa_start": 194,
          "aa_end": null,
          "aa_length": 586,
          "cds_start": 580,
          "cds_end": null,
          "cds_length": 1761,
          "cdna_start": 659,
          "cdna_end": null,
          "cdna_length": 1974,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "GPKNSYIA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.544_565delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": "p.Gly182fs",
          "transcript": "NM_001438293.1",
          "protein_id": "NP_001425222.1",
          "transcript_support_level": null,
          "aa_start": 182,
          "aa_end": null,
          "aa_length": 574,
          "cds_start": 544,
          "cds_end": null,
          "cds_length": 1725,
          "cdna_start": 623,
          "cdna_end": null,
          "cdna_length": 1938,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "GPKNSYIA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.580_601delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": "p.Gly194fs",
          "transcript": "NM_001438294.1",
          "protein_id": "NP_001425223.1",
          "transcript_support_level": null,
          "aa_start": 194,
          "aa_end": null,
          "aa_length": 557,
          "cds_start": 580,
          "cds_end": null,
          "cds_length": 1674,
          "cdna_start": 659,
          "cdna_end": null,
          "cdna_length": 1887,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "GPKNSYIA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.544_565delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": "p.Gly182fs",
          "transcript": "NM_001438295.1",
          "protein_id": "NP_001425224.1",
          "transcript_support_level": null,
          "aa_start": 182,
          "aa_end": null,
          "aa_length": 545,
          "cds_start": 544,
          "cds_end": null,
          "cds_length": 1638,
          "cdna_start": 623,
          "cdna_end": null,
          "cdna_length": 1851,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "GPKNSYIA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.451_472delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": "p.Gly151fs",
          "transcript": "ENST00000405598.5",
          "protein_id": "ENSP00000386087.1",
          "transcript_support_level": 5,
          "aa_start": 151,
          "aa_end": null,
          "aa_length": 543,
          "cds_start": 451,
          "cds_end": null,
          "cds_length": 1632,
          "cdna_start": 664,
          "cdna_end": null,
          "cdna_length": 1959,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "GPKNSYIA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.451_472delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": "p.Gly151fs",
          "transcript": "ENST00000650281.1",
          "protein_id": "ENSP00000497000.1",
          "transcript_support_level": null,
          "aa_start": 151,
          "aa_end": null,
          "aa_length": 543,
          "cds_start": 451,
          "cds_end": null,
          "cds_length": 1632,
          "cdna_start": 632,
          "cdna_end": null,
          "cdna_length": 1923,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "GPKNSYIA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.451_472delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": "p.Gly151fs",
          "transcript": "NM_145862.3",
          "protein_id": "NP_665861.1",
          "transcript_support_level": null,
          "aa_start": 151,
          "aa_end": null,
          "aa_length": 514,
          "cds_start": 451,
          "cds_end": null,
          "cds_length": 1545,
          "cdna_start": 530,
          "cdna_end": null,
          "cdna_length": 1758,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "GPKNSYIA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.451_472delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": "p.Gly151fs",
          "transcript": "ENST00000348295.7",
          "protein_id": "ENSP00000329012.5",
          "transcript_support_level": 5,
          "aa_start": 151,
          "aa_end": null,
          "aa_length": 514,
          "cds_start": 451,
          "cds_end": null,
          "cds_length": 1545,
          "cdna_start": 544,
          "cdna_end": null,
          "cdna_length": 1771,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "GPKNSYIA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.544_565delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": "p.Gly182fs",
          "transcript": "ENST00000439200.5",
          "protein_id": "ENSP00000408065.1",
          "transcript_support_level": 5,
          "aa_start": 182,
          "aa_end": null,
          "aa_length": 294,
          "cds_start": 544,
          "cds_end": null,
          "cds_length": 885,
          "cdna_start": 586,
          "cdna_end": null,
          "cdna_length": 906,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "GPKNSYIA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.451_472delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": "p.Gly151fs",
          "transcript": "ENST00000650233.1",
          "protein_id": "ENSP00000497699.1",
          "transcript_support_level": null,
          "aa_start": 151,
          "aa_end": null,
          "aa_length": 175,
          "cds_start": 451,
          "cds_end": null,
          "cds_length": 528,
          "cdna_start": 517,
          "cdna_end": null,
          "cdna_length": 573,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "GPKNSYIA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.451_472delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": "p.Gly151fs",
          "transcript": "ENST00000398017.3",
          "protein_id": "ENSP00000381099.3",
          "transcript_support_level": 5,
          "aa_start": 151,
          "aa_end": null,
          "aa_length": 161,
          "cds_start": 451,
          "cds_end": null,
          "cds_length": 486,
          "cdna_start": 699,
          "cdna_end": null,
          "cdna_length": 713,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "GPKNSYIA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.610_631delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": "p.Gly204fs",
          "transcript": "XM_011529839.3",
          "protein_id": "XP_011528141.1",
          "transcript_support_level": null,
          "aa_start": 204,
          "aa_end": null,
          "aa_length": 596,
          "cds_start": 610,
          "cds_end": null,
          "cds_length": 1791,
          "cdna_start": 2174,
          "cdna_end": null,
          "cdna_length": 3488,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "GPKNSYIA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.574_595delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": "p.Gly192fs",
          "transcript": "XM_017028560.2",
          "protein_id": "XP_016884049.1",
          "transcript_support_level": null,
          "aa_start": 192,
          "aa_end": null,
          "aa_length": 584,
          "cds_start": 574,
          "cds_end": null,
          "cds_length": 1755,
          "cdna_start": 654,
          "cdna_end": null,
          "cdna_length": 1968,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "GPKNSYIA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.610_631delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": "p.Gly204fs",
          "transcript": "XM_011529840.4",
          "protein_id": "XP_011528142.1",
          "transcript_support_level": null,
          "aa_start": 204,
          "aa_end": null,
          "aa_length": 567,
          "cds_start": 610,
          "cds_end": null,
          "cds_length": 1704,
          "cdna_start": 694,
          "cdna_end": null,
          "cdna_length": 1921,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "GPKNSYIA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.481_502delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": "p.Gly161fs",
          "transcript": "XM_024452148.2",
          "protein_id": "XP_024307916.1",
          "transcript_support_level": null,
          "aa_start": 161,
          "aa_end": null,
          "aa_length": 553,
          "cds_start": 481,
          "cds_end": null,
          "cds_length": 1662,
          "cdna_start": 2043,
          "cdna_end": null,
          "cdna_length": 3357,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "GPKNSYIA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.481_502delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": "p.Gly161fs",
          "transcript": "XM_024452149.2",
          "protein_id": "XP_024307917.1",
          "transcript_support_level": null,
          "aa_start": 161,
          "aa_end": null,
          "aa_length": 524,
          "cds_start": 481,
          "cds_end": null,
          "cds_length": 1575,
          "cdna_start": 2044,
          "cdna_end": null,
          "cdna_length": 3271,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "GPKNSYIA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 11,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.610_631delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": "p.Gly204fs",
          "transcript": "XM_011529844.3",
          "protein_id": "XP_011528146.1",
          "transcript_support_level": null,
          "aa_start": 204,
          "aa_end": null,
          "aa_length": 409,
          "cds_start": 610,
          "cds_end": null,
          "cds_length": 1230,
          "cdna_start": 702,
          "cdna_end": null,
          "cdna_length": 1374,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "n.451_472delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "ENST00000417588.5",
          "protein_id": "ENSP00000412901.1",
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1551,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "n.451_472delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "ENST00000433728.5",
          "protein_id": "ENSP00000404400.1",
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1580,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "n.451_472delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "ENST00000439346.6",
          "protein_id": "ENSP00000396903.2",
          "transcript_support_level": 4,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 991,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "n.*431_*452delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "ENST00000454252.2",
          "protein_id": "ENSP00000387451.2",
          "transcript_support_level": 3,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1094,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "n.451_472delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "ENST00000711048.1",
          "protein_id": "ENSP00000518557.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1586,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "n.680_701delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "XR_007067954.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1257,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 9,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "n.523_544delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "XR_007067955.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1100,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "n.681_702delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "XR_937806.3",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1264,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "n.681_702delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "XR_937807.3",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1263,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.-327_-306delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "NM_001257387.3",
          "protein_id": "NP_001244316.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 322,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 969,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1959,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.-213_-192delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "NM_001437942.1",
          "protein_id": "NP_001424871.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 322,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 969,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1520,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.-213_-192delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "ENST00000425190.7",
          "protein_id": "ENSP00000390244.2",
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 322,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 969,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1510,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "n.*431_*452delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "ENST00000454252.2",
          "protein_id": "ENSP00000387451.2",
          "transcript_support_level": 3,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1094,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.444+125_444+146delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "NM_001349956.3",
          "protein_id": "NP_001336885.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 476,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 1431,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1644,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 12,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.-71-5633_-71-5612delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "ENST00000649563.1",
          "protein_id": "ENSP00000496928.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 322,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 969,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1224,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "n.444+125_444+146delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "ENST00000433028.6",
          "protein_id": "ENSP00000403659.1",
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1349,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": 2,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "n.444+125_444+146delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "ENST00000448511.5",
          "protein_id": "ENSP00000404567.1",
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1532,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": 4,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.603+125_603+146delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "XM_047441107.1",
          "protein_id": "XP_047297063.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 529,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 1590,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1807,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "CHEK2",
          "gene_hgnc_id": 16627,
          "hgvs_c": "c.474+125_474+146delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": null,
          "transcript": "XM_011529842.3",
          "protein_id": "XP_011528144.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 486,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 1461,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1674,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "CHEK2",
      "gene_hgnc_id": 16627,
      "dbsnp": "rs1555926975",
      "frequency_reference_population": null,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 0,
      "gnomad_exomes_af": null,
      "gnomad_genomes_af": null,
      "gnomad_exomes_ac": null,
      "gnomad_genomes_ac": null,
      "gnomad_exomes_homalt": null,
      "gnomad_genomes_homalt": null,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 6.65,
      "phylop100way_prediction": "Uncertain_significance",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 16,
      "acmg_classification": "Pathogenic",
      "acmg_criteria": "PVS1,PP5_Very_Strong",
      "acmg_by_gene": [
        {
          "score": 16,
          "benign_score": 0,
          "pathogenic_score": 16,
          "criteria": [
            "PVS1",
            "PP5_Very_Strong"
          ],
          "verdict": "Pathogenic",
          "transcript": "ENST00000404276.6",
          "gene_symbol": "CHEK2",
          "hgnc_id": 16627,
          "effects": [
            "frameshift_variant"
          ],
          "inheritance_mode": "AD",
          "hgvs_c": "c.451_472delGGTCCTAAAAACTCTTACATTG",
          "hgvs_p": "p.Gly151fs"
        }
      ],
      "clinvar_disease": "Familial cancer of breast,Hereditary cancer-predisposing syndrome",
      "clinvar_classification": "Pathogenic",
      "clinvar_review_status": "criteria provided, multiple submitters, no conflicts",
      "clinvar_submissions_summary": "P:3",
      "phenotype_combined": "Hereditary cancer-predisposing syndrome|Familial cancer of breast",
      "pathogenicity_classification_combined": "Pathogenic",
      "custom_annotations": null
    }
  ],
  "message": null
}