← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 22-28725096-GCAATGTAAGAGTTTTTAGGACC-G (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=22&pos=28725096&ref=GCAATGTAAGAGTTTTTAGGACC&alt=G&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "22",
"pos": 28725096,
"ref": "GCAATGTAAGAGTTTTTAGGACC",
"alt": "G",
"effect": "frameshift_variant",
"transcript": "ENST00000404276.6",
"consequences": [
{
"aa_ref": "GPKNSYIA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.451_472delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": "p.Gly151fs",
"transcript": "NM_007194.4",
"protein_id": "NP_009125.1",
"transcript_support_level": null,
"aa_start": 151,
"aa_end": null,
"aa_length": 543,
"cds_start": 451,
"cds_end": null,
"cds_length": 1632,
"cdna_start": 530,
"cdna_end": null,
"cdna_length": 1844,
"mane_select": "ENST00000404276.6",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GPKNSYIA",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.451_472delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": "p.Gly151fs",
"transcript": "ENST00000404276.6",
"protein_id": "ENSP00000385747.1",
"transcript_support_level": 1,
"aa_start": 151,
"aa_end": null,
"aa_length": 543,
"cds_start": 451,
"cds_end": null,
"cds_length": 1632,
"cdna_start": 530,
"cdna_end": null,
"cdna_length": 1844,
"mane_select": "NM_007194.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GPKNSYIA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.580_601delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": "p.Gly194fs",
"transcript": "ENST00000382580.6",
"protein_id": "ENSP00000372023.2",
"transcript_support_level": 1,
"aa_start": 194,
"aa_end": null,
"aa_length": 586,
"cds_start": 580,
"cds_end": null,
"cds_length": 1761,
"cdna_start": 677,
"cdna_end": null,
"cdna_length": 1971,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "n.451_472delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "ENST00000416671.5",
"protein_id": "ENSP00000402225.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2560,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.444+125_444+146delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "ENST00000402731.6",
"protein_id": "ENSP00000384835.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 476,
"cds_start": -4,
"cds_end": null,
"cds_length": 1431,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1591,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.320-5633_320-5612delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "ENST00000403642.5",
"protein_id": "ENSP00000384919.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 452,
"cds_start": -4,
"cds_end": null,
"cds_length": 1359,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1359,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GPKNSYIA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.580_601delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": "p.Gly194fs",
"transcript": "NM_001005735.3",
"protein_id": "NP_001005735.1",
"transcript_support_level": null,
"aa_start": 194,
"aa_end": null,
"aa_length": 586,
"cds_start": 580,
"cds_end": null,
"cds_length": 1761,
"cdna_start": 659,
"cdna_end": null,
"cdna_length": 1974,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GPKNSYIA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.544_565delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": "p.Gly182fs",
"transcript": "NM_001438293.1",
"protein_id": "NP_001425222.1",
"transcript_support_level": null,
"aa_start": 182,
"aa_end": null,
"aa_length": 574,
"cds_start": 544,
"cds_end": null,
"cds_length": 1725,
"cdna_start": 623,
"cdna_end": null,
"cdna_length": 1938,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GPKNSYIA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.580_601delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": "p.Gly194fs",
"transcript": "NM_001438294.1",
"protein_id": "NP_001425223.1",
"transcript_support_level": null,
"aa_start": 194,
"aa_end": null,
"aa_length": 557,
"cds_start": 580,
"cds_end": null,
"cds_length": 1674,
"cdna_start": 659,
"cdna_end": null,
"cdna_length": 1887,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GPKNSYIA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.544_565delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": "p.Gly182fs",
"transcript": "NM_001438295.1",
"protein_id": "NP_001425224.1",
"transcript_support_level": null,
"aa_start": 182,
"aa_end": null,
"aa_length": 545,
"cds_start": 544,
"cds_end": null,
"cds_length": 1638,
"cdna_start": 623,
"cdna_end": null,
"cdna_length": 1851,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GPKNSYIA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.451_472delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": "p.Gly151fs",
"transcript": "ENST00000405598.5",
"protein_id": "ENSP00000386087.1",
"transcript_support_level": 5,
"aa_start": 151,
"aa_end": null,
"aa_length": 543,
"cds_start": 451,
"cds_end": null,
"cds_length": 1632,
"cdna_start": 664,
"cdna_end": null,
"cdna_length": 1959,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GPKNSYIA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.451_472delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": "p.Gly151fs",
"transcript": "ENST00000650281.1",
"protein_id": "ENSP00000497000.1",
"transcript_support_level": null,
"aa_start": 151,
"aa_end": null,
"aa_length": 543,
"cds_start": 451,
"cds_end": null,
"cds_length": 1632,
"cdna_start": 632,
"cdna_end": null,
"cdna_length": 1923,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GPKNSYIA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.451_472delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": "p.Gly151fs",
"transcript": "NM_145862.3",
"protein_id": "NP_665861.1",
"transcript_support_level": null,
"aa_start": 151,
"aa_end": null,
"aa_length": 514,
"cds_start": 451,
"cds_end": null,
"cds_length": 1545,
"cdna_start": 530,
"cdna_end": null,
"cdna_length": 1758,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GPKNSYIA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.451_472delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": "p.Gly151fs",
"transcript": "ENST00000348295.7",
"protein_id": "ENSP00000329012.5",
"transcript_support_level": 5,
"aa_start": 151,
"aa_end": null,
"aa_length": 514,
"cds_start": 451,
"cds_end": null,
"cds_length": 1545,
"cdna_start": 544,
"cdna_end": null,
"cdna_length": 1771,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GPKNSYIA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.544_565delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": "p.Gly182fs",
"transcript": "ENST00000439200.5",
"protein_id": "ENSP00000408065.1",
"transcript_support_level": 5,
"aa_start": 182,
"aa_end": null,
"aa_length": 294,
"cds_start": 544,
"cds_end": null,
"cds_length": 885,
"cdna_start": 586,
"cdna_end": null,
"cdna_length": 906,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GPKNSYIA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.451_472delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": "p.Gly151fs",
"transcript": "ENST00000650233.1",
"protein_id": "ENSP00000497699.1",
"transcript_support_level": null,
"aa_start": 151,
"aa_end": null,
"aa_length": 175,
"cds_start": 451,
"cds_end": null,
"cds_length": 528,
"cdna_start": 517,
"cdna_end": null,
"cdna_length": 573,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GPKNSYIA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.451_472delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": "p.Gly151fs",
"transcript": "ENST00000398017.3",
"protein_id": "ENSP00000381099.3",
"transcript_support_level": 5,
"aa_start": 151,
"aa_end": null,
"aa_length": 161,
"cds_start": 451,
"cds_end": null,
"cds_length": 486,
"cdna_start": 699,
"cdna_end": null,
"cdna_length": 713,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GPKNSYIA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.610_631delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": "p.Gly204fs",
"transcript": "XM_011529839.3",
"protein_id": "XP_011528141.1",
"transcript_support_level": null,
"aa_start": 204,
"aa_end": null,
"aa_length": 596,
"cds_start": 610,
"cds_end": null,
"cds_length": 1791,
"cdna_start": 2174,
"cdna_end": null,
"cdna_length": 3488,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GPKNSYIA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.574_595delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": "p.Gly192fs",
"transcript": "XM_017028560.2",
"protein_id": "XP_016884049.1",
"transcript_support_level": null,
"aa_start": 192,
"aa_end": null,
"aa_length": 584,
"cds_start": 574,
"cds_end": null,
"cds_length": 1755,
"cdna_start": 654,
"cdna_end": null,
"cdna_length": 1968,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GPKNSYIA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.610_631delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": "p.Gly204fs",
"transcript": "XM_011529840.4",
"protein_id": "XP_011528142.1",
"transcript_support_level": null,
"aa_start": 204,
"aa_end": null,
"aa_length": 567,
"cds_start": 610,
"cds_end": null,
"cds_length": 1704,
"cdna_start": 694,
"cdna_end": null,
"cdna_length": 1921,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GPKNSYIA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.481_502delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": "p.Gly161fs",
"transcript": "XM_024452148.2",
"protein_id": "XP_024307916.1",
"transcript_support_level": null,
"aa_start": 161,
"aa_end": null,
"aa_length": 553,
"cds_start": 481,
"cds_end": null,
"cds_length": 1662,
"cdna_start": 2043,
"cdna_end": null,
"cdna_length": 3357,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GPKNSYIA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.481_502delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": "p.Gly161fs",
"transcript": "XM_024452149.2",
"protein_id": "XP_024307917.1",
"transcript_support_level": null,
"aa_start": 161,
"aa_end": null,
"aa_length": 524,
"cds_start": 481,
"cds_end": null,
"cds_length": 1575,
"cdna_start": 2044,
"cdna_end": null,
"cdna_length": 3271,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GPKNSYIA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.610_631delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": "p.Gly204fs",
"transcript": "XM_011529844.3",
"protein_id": "XP_011528146.1",
"transcript_support_level": null,
"aa_start": 204,
"aa_end": null,
"aa_length": 409,
"cds_start": 610,
"cds_end": null,
"cds_length": 1230,
"cdna_start": 702,
"cdna_end": null,
"cdna_length": 1374,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "n.451_472delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "ENST00000417588.5",
"protein_id": "ENSP00000412901.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1551,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "n.451_472delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "ENST00000433728.5",
"protein_id": "ENSP00000404400.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1580,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "n.451_472delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "ENST00000439346.6",
"protein_id": "ENSP00000396903.2",
"transcript_support_level": 4,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 991,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "n.*431_*452delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "ENST00000454252.2",
"protein_id": "ENSP00000387451.2",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1094,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "n.451_472delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "ENST00000711048.1",
"protein_id": "ENSP00000518557.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1586,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "n.680_701delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "XR_007067954.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1257,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "n.523_544delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "XR_007067955.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1100,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "n.681_702delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "XR_937806.3",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1264,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "n.681_702delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "XR_937807.3",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1263,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.-327_-306delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "NM_001257387.3",
"protein_id": "NP_001244316.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 322,
"cds_start": -4,
"cds_end": null,
"cds_length": 969,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1959,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.-213_-192delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "NM_001437942.1",
"protein_id": "NP_001424871.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 322,
"cds_start": -4,
"cds_end": null,
"cds_length": 969,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1520,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.-213_-192delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "ENST00000425190.7",
"protein_id": "ENSP00000390244.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 322,
"cds_start": -4,
"cds_end": null,
"cds_length": 969,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1510,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "n.*431_*452delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "ENST00000454252.2",
"protein_id": "ENSP00000387451.2",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1094,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.444+125_444+146delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "NM_001349956.3",
"protein_id": "NP_001336885.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 476,
"cds_start": -4,
"cds_end": null,
"cds_length": 1431,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1644,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.-71-5633_-71-5612delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "ENST00000649563.1",
"protein_id": "ENSP00000496928.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 322,
"cds_start": -4,
"cds_end": null,
"cds_length": 969,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1224,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "n.444+125_444+146delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "ENST00000433028.6",
"protein_id": "ENSP00000403659.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1349,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "n.444+125_444+146delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "ENST00000448511.5",
"protein_id": "ENSP00000404567.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1532,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.603+125_603+146delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "XM_047441107.1",
"protein_id": "XP_047297063.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 529,
"cds_start": -4,
"cds_end": null,
"cds_length": 1590,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1807,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"hgvs_c": "c.474+125_474+146delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": null,
"transcript": "XM_011529842.3",
"protein_id": "XP_011528144.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 486,
"cds_start": -4,
"cds_end": null,
"cds_length": 1461,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1674,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "CHEK2",
"gene_hgnc_id": 16627,
"dbsnp": "rs1555926975",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 6.65,
"phylop100way_prediction": "Uncertain_significance",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 16,
"acmg_classification": "Pathogenic",
"acmg_criteria": "PVS1,PP5_Very_Strong",
"acmg_by_gene": [
{
"score": 16,
"benign_score": 0,
"pathogenic_score": 16,
"criteria": [
"PVS1",
"PP5_Very_Strong"
],
"verdict": "Pathogenic",
"transcript": "ENST00000404276.6",
"gene_symbol": "CHEK2",
"hgnc_id": 16627,
"effects": [
"frameshift_variant"
],
"inheritance_mode": "AD",
"hgvs_c": "c.451_472delGGTCCTAAAAACTCTTACATTG",
"hgvs_p": "p.Gly151fs"
}
],
"clinvar_disease": "Familial cancer of breast,Hereditary cancer-predisposing syndrome",
"clinvar_classification": "Pathogenic",
"clinvar_review_status": "criteria provided, multiple submitters, no conflicts",
"clinvar_submissions_summary": "P:3",
"phenotype_combined": "Hereditary cancer-predisposing syndrome|Familial cancer of breast",
"pathogenicity_classification_combined": "Pathogenic",
"custom_annotations": null
}
],
"message": null
}