← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 22-37069345-C-CTGGGGTGGGGTGGGGTGGGGTGGGGTGGGGTGGGG (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=22&pos=37069345&ref=C&alt=CTGGGGTGGGGTGGGGTGGGGTGGGGTGGGGTGGGG&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "22",
"pos": 37069345,
"ref": "C",
"alt": "CTGGGGTGGGGTGGGGTGGGGTGGGGTGGGGTGGGG",
"effect": "splice_acceptor_variant,intron_variant",
"transcript": "NM_001374504.1",
"consequences": [
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_acceptor_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": 15,
"intron_rank_end": null,
"gene_symbol": "TMPRSS6",
"gene_hgnc_id": 16517,
"hgvs_c": "c.1842-2_1842-1insCCCCACCCCACCCCACCCCACCCCACCCCACCCCA",
"hgvs_p": null,
"transcript": "NM_001374504.1",
"protein_id": "NP_001361433.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 802,
"cds_start": -4,
"cds_end": null,
"cds_length": 2409,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3265,
"mane_select": "ENST00000676104.1",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_acceptor_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": 15,
"intron_rank_end": null,
"gene_symbol": "TMPRSS6",
"gene_hgnc_id": 16517,
"hgvs_c": "c.1842-2_1842-1insCCCCACCCCACCCCACCCCACCCCACCCCACCCCA",
"hgvs_p": null,
"transcript": "ENST00000676104.1",
"protein_id": "ENSP00000501573.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 802,
"cds_start": -4,
"cds_end": null,
"cds_length": 2409,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3265,
"mane_select": "NM_001374504.1",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_acceptor_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": 15,
"intron_rank_end": null,
"gene_symbol": "TMPRSS6",
"gene_hgnc_id": 16517,
"hgvs_c": "c.1842-2_1842-1insCCCCACCCCACCCCACCCCACCCCACCCCACCCCA",
"hgvs_p": null,
"transcript": "ENST00000406856.7",
"protein_id": "ENSP00000384964.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 824,
"cds_start": -4,
"cds_end": null,
"cds_length": 2475,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3331,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_acceptor_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": 15,
"intron_rank_end": null,
"gene_symbol": "TMPRSS6",
"gene_hgnc_id": 16517,
"hgvs_c": "c.1842-2_1842-1insCCCCACCCCACCCCACCCCACCCCACCCCACCCCA",
"hgvs_p": null,
"transcript": "ENST00000346753.9",
"protein_id": "ENSP00000334962.6",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 802,
"cds_start": -4,
"cds_end": null,
"cds_length": 2409,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3194,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_acceptor_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": 15,
"intron_rank_end": null,
"gene_symbol": "TMPRSS6",
"gene_hgnc_id": 16517,
"hgvs_c": "c.1842-2_1842-1insCCCCACCCCACCCCACCCCACCCCACCCCACCCCA",
"hgvs_p": null,
"transcript": "ENST00000406725.6",
"protein_id": "ENSP00000385453.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 802,
"cds_start": -4,
"cds_end": null,
"cds_length": 2409,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3125,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_acceptor_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": 15,
"intron_rank_end": null,
"gene_symbol": "TMPRSS6",
"gene_hgnc_id": 16517,
"hgvs_c": "c.1842-2_1842-1insCCCCACCCCACCCCACCCCACCCCACCCCACCCCA",
"hgvs_p": null,
"transcript": "NM_001289000.2",
"protein_id": "NP_001275929.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 824,
"cds_start": -4,
"cds_end": null,
"cds_length": 2475,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3331,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_acceptor_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": 15,
"intron_rank_end": null,
"gene_symbol": "TMPRSS6",
"gene_hgnc_id": 16517,
"hgvs_c": "c.1842-2_1842-1insCCCCACCCCACCCCACCCCACCCCACCCCACCCCA",
"hgvs_p": null,
"transcript": "ENST00000381792.6",
"protein_id": "ENSP00000371211.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 824,
"cds_start": -4,
"cds_end": null,
"cds_length": 2475,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3260,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_acceptor_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": 15,
"intron_rank_end": null,
"gene_symbol": "TMPRSS6",
"gene_hgnc_id": 16517,
"hgvs_c": "c.1842-2_1842-1insCCCCACCCCACCCCACCCCACCCCACCCCACCCCA",
"hgvs_p": null,
"transcript": "NM_001289001.2",
"protein_id": "NP_001275930.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 802,
"cds_start": -4,
"cds_end": null,
"cds_length": 2409,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3153,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_acceptor_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": 15,
"intron_rank_end": null,
"gene_symbol": "TMPRSS6",
"gene_hgnc_id": 16517,
"hgvs_c": "c.1842-2_1842-1insCCCCACCCCACCCCACCCCACCCCACCCCACCCCA",
"hgvs_p": null,
"transcript": "NM_153609.4",
"protein_id": "NP_705837.2",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 802,
"cds_start": -4,
"cds_end": null,
"cds_length": 2409,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3197,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_acceptor_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": 15,
"intron_rank_end": null,
"gene_symbol": "TMPRSS6",
"gene_hgnc_id": 16517,
"hgvs_c": "c.1842-2_1842-1insCCCCACCCCACCCCACCCCACCCCACCCCACCCCA",
"hgvs_p": null,
"transcript": "XM_024452167.2",
"protein_id": "XP_024307935.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 824,
"cds_start": -4,
"cds_end": null,
"cds_length": 2475,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3202,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_acceptor_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": 15,
"intron_rank_end": null,
"gene_symbol": "TMPRSS6",
"gene_hgnc_id": 16517,
"hgvs_c": "c.1842-2_1842-1insCCCCACCCCACCCCACCCCACCCCACCCCACCCCA",
"hgvs_p": null,
"transcript": "XM_024452168.2",
"protein_id": "XP_024307936.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 824,
"cds_start": -4,
"cds_end": null,
"cds_length": 2475,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3219,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_acceptor_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": 12,
"intron_rank_end": null,
"gene_symbol": "TMPRSS6",
"gene_hgnc_id": 16517,
"hgvs_c": "c.1410-2_1410-1insCCCCACCCCACCCCACCCCACCCCACCCCACCCCA",
"hgvs_p": null,
"transcript": "XM_011529989.3",
"protein_id": "XP_011528291.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 680,
"cds_start": -4,
"cds_end": null,
"cds_length": 2043,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2899,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_acceptor_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": 12,
"intron_rank_end": null,
"gene_symbol": "TMPRSS6",
"gene_hgnc_id": 16517,
"hgvs_c": "c.1410-2_1410-1insCCCCACCCCACCCCACCCCACCCCACCCCACCCCA",
"hgvs_p": null,
"transcript": "XM_047441170.1",
"protein_id": "XP_047297126.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 658,
"cds_start": -4,
"cds_end": null,
"cds_length": 1977,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2833,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"splice_acceptor_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": 12,
"intron_rank_end": null,
"gene_symbol": "TMPRSS6",
"gene_hgnc_id": 16517,
"hgvs_c": "c.1410-2_1410-1insCCCCACCCCACCCCACCCCACCCCACCCCACCCCA",
"hgvs_p": null,
"transcript": "XM_047441171.1",
"protein_id": "XP_047297127.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 658,
"cds_start": -4,
"cds_end": null,
"cds_length": 1977,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2721,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "TMPRSS6",
"gene_hgnc_id": 16517,
"dbsnp": "rs60484081",
"frequency_reference_population": 0.000021988653,
"hom_count_reference_population": 0,
"allele_count_reference_population": 2,
"gnomad_exomes_af": null,
"gnomad_genomes_af": 0.0000219887,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": 2,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": 0,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 5.936,
"phylop100way_prediction": "Uncertain_significance",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 4,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "PVS1_Strong",
"acmg_by_gene": [
{
"score": 4,
"benign_score": 0,
"pathogenic_score": 4,
"criteria": [
"PVS1_Strong"
],
"verdict": "Uncertain_significance",
"transcript": "NM_001374504.1",
"gene_symbol": "TMPRSS6",
"hgnc_id": 16517,
"effects": [
"splice_acceptor_variant",
"intron_variant"
],
"inheritance_mode": "AR",
"hgvs_c": "c.1842-2_1842-1insCCCCACCCCACCCCACCCCACCCCACCCCACCCCA",
"hgvs_p": null
}
],
"clinvar_disease": "",
"clinvar_classification": "",
"clinvar_review_status": "",
"clinvar_submissions_summary": "",
"phenotype_combined": null,
"pathogenicity_classification_combined": null,
"custom_annotations": null
}
],
"message": null
}