← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 3-10146488-T-TTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=3&pos=10146488&ref=T&alt=TTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "3",
"pos": 10146488,
"ref": "T",
"alt": "TTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA",
"effect": "intron_variant",
"transcript": "ENST00000256474.3",
"consequences": [
{
"aa_ref": "T",
"aa_alt": "ITTFACPDRSPLALQRCRD?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "VHL",
"gene_hgnc_id": 12687,
"hgvs_c": "c.341-25_370dupTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA",
"hgvs_p": "p.Thr124fs",
"transcript": "NM_000551.4",
"protein_id": "NP_000542.1",
"transcript_support_level": null,
"aa_start": 124,
"aa_end": null,
"aa_length": 213,
"cds_start": 371,
"cds_end": null,
"cds_length": 642,
"cdna_start": 441,
"cdna_end": null,
"cdna_length": 4414,
"mane_select": "ENST00000256474.3",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "VHL",
"gene_hgnc_id": 12687,
"hgvs_c": "c.341-26_341-25insTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA",
"hgvs_p": null,
"transcript": "ENST00000256474.3",
"protein_id": "ENSP00000256474.3",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 213,
"cds_start": -4,
"cds_end": null,
"cds_length": 642,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4414,
"mane_select": "NM_000551.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "VHL",
"gene_hgnc_id": 12687,
"hgvs_c": "c.341-3299_341-3298insTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA",
"hgvs_p": null,
"transcript": "ENST00000345392.3",
"protein_id": "ENSP00000344757.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 172,
"cds_start": -4,
"cds_end": null,
"cds_length": 519,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4281,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "VHL",
"gene_hgnc_id": 12687,
"hgvs_c": "n.1221-26_1221-25insTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA",
"hgvs_p": null,
"transcript": "ENST00000477538.2",
"protein_id": null,
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5224,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "VHL",
"gene_hgnc_id": 12687,
"hgvs_c": "n.670-25_699dupTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA",
"hgvs_p": null,
"transcript": "NR_176335.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4673,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "VHL",
"gene_hgnc_id": 12687,
"hgvs_c": "c.341-26_341-25insTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA",
"hgvs_p": null,
"transcript": "ENST00000696153.2",
"protein_id": "ENSP00000512444.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 250,
"cds_start": -4,
"cds_end": null,
"cds_length": 753,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4534,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "VHL",
"gene_hgnc_id": 12687,
"hgvs_c": "c.341-26_341-25insTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA",
"hgvs_p": null,
"transcript": "ENST00000713811.1",
"protein_id": "ENSP00000519117.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4529,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "VHL",
"gene_hgnc_id": 12687,
"hgvs_c": "c.*18-3298_*18-3244dupTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA",
"hgvs_p": null,
"transcript": "NM_001354723.2",
"protein_id": "NP_001341652.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 193,
"cds_start": -4,
"cds_end": null,
"cds_length": 582,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4550,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "VHL",
"gene_hgnc_id": 12687,
"hgvs_c": "c.*18-3299_*18-3298insTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA",
"hgvs_p": null,
"transcript": "ENST00000696143.2",
"protein_id": "ENSP00000512435.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 193,
"cds_start": -4,
"cds_end": null,
"cds_length": 582,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4512,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "VHL",
"gene_hgnc_id": 12687,
"hgvs_c": "c.341-3298_341-3244dupTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA",
"hgvs_p": null,
"transcript": "NM_198156.3",
"protein_id": "NP_937799.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 172,
"cds_start": -4,
"cds_end": null,
"cds_length": 519,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4291,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "VHL",
"gene_hgnc_id": 12687,
"hgvs_c": "c.341-121_341-120insTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA",
"hgvs_p": null,
"transcript": "ENST00000713982.1",
"protein_id": "ENSP00000519273.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 140,
"cds_start": -4,
"cds_end": null,
"cds_length": 423,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4319,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "VHL",
"gene_hgnc_id": 12687,
"hgvs_c": "c.220-26_220-25insTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA",
"hgvs_p": null,
"transcript": "ENST00000713812.1",
"protein_id": "ENSP00000519118.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 117,
"cds_start": -4,
"cds_end": null,
"cds_length": 354,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4285,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "VHL",
"gene_hgnc_id": 12687,
"hgvs_c": "c.37-26_37-25insTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA",
"hgvs_p": null,
"transcript": "ENST00000713815.1",
"protein_id": "ENSP00000519120.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 56,
"cds_start": -4,
"cds_end": null,
"cds_length": 171,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4091,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "VHL",
"gene_hgnc_id": 12687,
"hgvs_c": "n.*18-26_*18-25insTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA",
"hgvs_p": null,
"transcript": "ENST00000696142.2",
"protein_id": "ENSP00000512434.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4665,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "VHL",
"gene_hgnc_id": 12687,
"hgvs_c": "n.1236-3299_1236-3298insTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA",
"hgvs_p": null,
"transcript": "ENST00000713813.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5116,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "VHL",
"gene_hgnc_id": 12687,
"hgvs_c": "n.*18-26_*18-25insTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA",
"hgvs_p": null,
"transcript": "ENST00000713814.1",
"protein_id": "ENSP00000519119.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4462,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "VHL",
"gene_hgnc_id": 12687,
"hgvs_c": "n.344-26_344-25insTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA",
"hgvs_p": null,
"transcript": "ENST00000713816.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4347,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "VHL",
"gene_hgnc_id": 12687,
"dbsnp": "rs1553619923",
"frequency_reference_population": 0.000006572375,
"hom_count_reference_population": 0,
"allele_count_reference_population": 1,
"gnomad_exomes_af": 0.00000342349,
"gnomad_genomes_af": 0.00000657237,
"gnomad_exomes_ac": 5,
"gnomad_genomes_ac": 1,
"gnomad_exomes_homalt": 0,
"gnomad_genomes_homalt": 0,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 1.443,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 0,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "",
"acmg_by_gene": [
{
"score": 0,
"benign_score": 0,
"pathogenic_score": 0,
"criteria": [],
"verdict": "Uncertain_significance",
"transcript": "ENST00000256474.3",
"gene_symbol": "VHL",
"hgnc_id": 12687,
"effects": [
"intron_variant"
],
"inheritance_mode": "AD,AR",
"hgvs_c": "c.341-26_341-25insTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA",
"hgvs_p": null
}
],
"clinvar_disease": "Chuvash polycythemia,Hereditary cancer-predisposing syndrome,Von Hippel-Lindau syndrome",
"clinvar_classification": "Uncertain significance",
"clinvar_review_status": "reviewed by expert panel",
"clinvar_submissions_summary": "LP:1 US:3",
"phenotype_combined": "Chuvash polycythemia;Von Hippel-Lindau syndrome|Von Hippel-Lindau syndrome|Hereditary cancer-predisposing syndrome",
"pathogenicity_classification_combined": "Uncertain significance",
"custom_annotations": null
}
],
"message": null
}