← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 3-41224574-CTGTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGG-C (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=3&pos=41224574&ref=CTGTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGG&alt=C&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "3",
      "pos": 41224574,
      "ref": "CTGTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGG",
      "alt": "C",
      "effect": "disruptive_inframe_deletion",
      "transcript": "ENST00000349496.11",
      "consequences": [
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "NM_001904.4",
          "protein_id": "NP_001895.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 279,
          "cdna_end": null,
          "cdna_length": 3661,
          "mane_select": "ENST00000349496.11",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": true,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000349496.11",
          "protein_id": "ENSP00000344456.5",
          "transcript_support_level": 1,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 279,
          "cdna_end": null,
          "cdna_length": 3661,
          "mane_select": "NM_001904.4",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000396183.7",
          "protein_id": "ENSP00000379486.3",
          "transcript_support_level": 1,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 350,
          "cdna_end": null,
          "cdna_length": 3268,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000396185.8",
          "protein_id": "ENSP00000379488.3",
          "transcript_support_level": 1,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 395,
          "cdna_end": null,
          "cdna_length": 3472,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": true,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000645982.1",
          "protein_id": "ENSP00000494845.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 342,
          "cdna_end": null,
          "cdna_length": 2778,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": true,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "n.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": null,
          "transcript": "ENST00000715152.1",
          "protein_id": "ENSP00000520353.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3211,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000645927.2",
          "protein_id": "ENSP00000495287.2",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 789,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2370,
          "cdna_start": 312,
          "cdna_end": null,
          "cdna_length": 3230,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000645276.1",
          "protein_id": "ENSP00000494654.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 783,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2352,
          "cdna_start": 279,
          "cdna_end": null,
          "cdna_length": 3127,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "NM_001098209.2",
          "protein_id": "NP_001091679.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 279,
          "cdna_end": null,
          "cdna_length": 3356,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "NM_001098210.2",
          "protein_id": "NP_001091680.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 279,
          "cdna_end": null,
          "cdna_length": 3197,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "NM_001438871.1",
          "protein_id": "NP_001425800.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 352,
          "cdna_end": null,
          "cdna_length": 3270,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "NM_001438872.1",
          "protein_id": "NP_001425801.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 352,
          "cdna_end": null,
          "cdna_length": 3734,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "NM_001438873.1",
          "protein_id": "NP_001425802.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 364,
          "cdna_end": null,
          "cdna_length": 3746,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000405570.6",
          "protein_id": "ENSP00000385604.1",
          "transcript_support_level": 2,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 263,
          "cdna_end": null,
          "cdna_length": 2642,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000431914.6",
          "protein_id": "ENSP00000412219.2",
          "transcript_support_level": 4,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 216,
          "cdna_end": null,
          "cdna_length": 2749,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000433400.6",
          "protein_id": "ENSP00000387455.2",
          "transcript_support_level": 4,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 826,
          "cdna_end": null,
          "cdna_length": 3431,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000441708.2",
          "protein_id": "ENSP00000401599.2",
          "transcript_support_level": 4,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 1505,
          "cdna_end": null,
          "cdna_length": 3906,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000450969.6",
          "protein_id": "ENSP00000409302.2",
          "transcript_support_level": 4,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 383,
          "cdna_end": null,
          "cdna_length": 2764,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000642248.1",
          "protein_id": "ENSP00000495244.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 241,
          "cdna_end": null,
          "cdna_length": 2775,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000642315.1",
          "protein_id": "ENSP00000495076.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 352,
          "cdna_end": null,
          "cdna_length": 2890,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000642426.1",
          "protein_id": "ENSP00000495719.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 291,
          "cdna_end": null,
          "cdna_length": 2720,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000642992.1",
          "protein_id": "ENSP00000496385.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 250,
          "cdna_end": null,
          "cdna_length": 3134,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000643031.1",
          "protein_id": "ENSP00000495450.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 350,
          "cdna_end": null,
          "cdna_length": 3267,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000643297.1",
          "protein_id": "ENSP00000494677.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 384,
          "cdna_end": null,
          "cdna_length": 3283,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000643541.1",
          "protein_id": "ENSP00000494411.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 390,
          "cdna_end": null,
          "cdna_length": 3278,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000643977.1",
          "protein_id": "ENSP00000494053.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 197,
          "cdna_end": null,
          "cdna_length": 3036,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000643992.1",
          "protein_id": "ENSP00000493610.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 305,
          "cdna_end": null,
          "cdna_length": 2858,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000644867.1",
          "protein_id": "ENSP00000495992.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 235,
          "cdna_end": null,
          "cdna_length": 3087,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000645210.1",
          "protein_id": "ENSP00000496180.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 286,
          "cdna_end": null,
          "cdna_length": 3195,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000645320.1",
          "protein_id": "ENSP00000495360.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 1908,
          "cdna_end": null,
          "cdna_length": 4735,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000646369.1",
          "protein_id": "ENSP00000494914.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 220,
          "cdna_end": null,
          "cdna_length": 2607,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000646725.1",
          "protein_id": "ENSP00000496021.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 160,
          "cdna_end": null,
          "cdna_length": 2744,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000647390.1",
          "protein_id": "ENSP00000493533.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 250,
          "cdna_end": null,
          "cdna_length": 2784,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000647413.2",
          "protein_id": "ENSP00000493583.2",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 185,
          "cdna_end": null,
          "cdna_length": 3567,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000644873.1",
          "protein_id": "ENSP00000496511.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 780,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2343,
          "cdna_start": 246,
          "cdna_end": null,
          "cdna_length": 3086,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000715148.1",
          "protein_id": "ENSP00000520349.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 779,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2340,
          "cdna_start": 374,
          "cdna_end": null,
          "cdna_length": 3447,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000715151.1",
          "protein_id": "ENSP00000520352.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 779,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2340,
          "cdna_start": 296,
          "cdna_end": null,
          "cdna_length": 3207,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.44_94delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val15_Gly31del",
          "transcript": "NM_001330729.2",
          "protein_id": "NP_001317658.1",
          "transcript_support_level": null,
          "aa_start": 15,
          "aa_end": null,
          "aa_length": 774,
          "cds_start": 44,
          "cds_end": null,
          "cds_length": 2325,
          "cdna_start": 411,
          "cdna_end": null,
          "cdna_length": 3488,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.44_94delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val15_Gly31del",
          "transcript": "ENST00000426215.6",
          "protein_id": "ENSP00000400508.2",
          "transcript_support_level": 4,
          "aa_start": 15,
          "aa_end": null,
          "aa_length": 774,
          "cds_start": 44,
          "cds_end": null,
          "cds_length": 2325,
          "cdna_start": 429,
          "cdna_end": null,
          "cdna_length": 3811,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.44_94delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val15_Gly31del",
          "transcript": "ENST00000453024.6",
          "protein_id": "ENSP00000411226.1",
          "transcript_support_level": 2,
          "aa_start": 15,
          "aa_end": null,
          "aa_length": 774,
          "cds_start": 44,
          "cds_end": null,
          "cds_length": 2325,
          "cdna_start": 471,
          "cdna_end": null,
          "cdna_length": 3052,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.44_94delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val15_Gly31del",
          "transcript": "ENST00000642836.1",
          "protein_id": "ENSP00000496295.1",
          "transcript_support_level": null,
          "aa_start": 15,
          "aa_end": null,
          "aa_length": 774,
          "cds_start": 44,
          "cds_end": null,
          "cds_length": 2325,
          "cdna_start": 322,
          "cdna_end": null,
          "cdna_length": 3232,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.44_94delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val15_Gly31del",
          "transcript": "ENST00000644524.1",
          "protein_id": "ENSP00000494780.1",
          "transcript_support_level": null,
          "aa_start": 15,
          "aa_end": null,
          "aa_length": 774,
          "cds_start": 44,
          "cds_end": null,
          "cds_length": 2325,
          "cdna_start": 547,
          "cdna_end": null,
          "cdna_length": 3388,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.44_94delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val15_Gly31del",
          "transcript": "ENST00000644678.1",
          "protein_id": "ENSP00000495794.1",
          "transcript_support_level": null,
          "aa_start": 15,
          "aa_end": null,
          "aa_length": 774,
          "cds_start": 44,
          "cds_end": null,
          "cds_length": 2325,
          "cdna_start": 497,
          "cdna_end": null,
          "cdna_length": 3321,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.44_94delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val15_Gly31del",
          "transcript": "ENST00000645493.1",
          "protein_id": "ENSP00000494467.1",
          "transcript_support_level": null,
          "aa_start": 15,
          "aa_end": null,
          "aa_length": 774,
          "cds_start": 44,
          "cds_end": null,
          "cds_length": 2325,
          "cdna_start": 352,
          "cdna_end": null,
          "cdna_length": 3196,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.44_94delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val15_Gly31del",
          "transcript": "ENST00000645900.1",
          "protein_id": "ENSP00000495286.1",
          "transcript_support_level": null,
          "aa_start": 15,
          "aa_end": null,
          "aa_length": 774,
          "cds_start": 44,
          "cds_end": null,
          "cds_length": 2325,
          "cdna_start": 398,
          "cdna_end": null,
          "cdna_length": 3284,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.44_94delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val15_Gly31del",
          "transcript": "ENST00000646116.1",
          "protein_id": "ENSP00000495426.1",
          "transcript_support_level": null,
          "aa_start": 15,
          "aa_end": null,
          "aa_length": 774,
          "cds_start": 44,
          "cds_end": null,
          "cds_length": 2325,
          "cdna_start": 391,
          "cdna_end": null,
          "cdna_length": 2770,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.44_94delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val15_Gly31del",
          "transcript": "ENST00000646174.1",
          "protein_id": "ENSP00000495161.1",
          "transcript_support_level": null,
          "aa_start": 15,
          "aa_end": null,
          "aa_length": 774,
          "cds_start": 44,
          "cds_end": null,
          "cds_length": 2325,
          "cdna_start": 251,
          "cdna_end": null,
          "cdna_length": 2933,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.44_94delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val15_Gly31del",
          "transcript": "ENST00000646381.1",
          "protein_id": "ENSP00000496067.1",
          "transcript_support_level": null,
          "aa_start": 15,
          "aa_end": null,
          "aa_length": 774,
          "cds_start": 44,
          "cds_end": null,
          "cds_length": 2325,
          "cdna_start": 410,
          "cdna_end": null,
          "cdna_length": 3249,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.44_94delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val15_Gly31del",
          "transcript": "ENST00000647264.1",
          "protein_id": "ENSP00000494849.1",
          "transcript_support_level": null,
          "aa_start": 15,
          "aa_end": null,
          "aa_length": 752,
          "cds_start": 44,
          "cds_end": null,
          "cds_length": 2259,
          "cdna_start": 446,
          "cdna_end": null,
          "cdna_length": 2994,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000642886.1",
          "protein_id": "ENSP00000496020.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 744,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2235,
          "cdna_start": 298,
          "cdna_end": null,
          "cdna_length": 3039,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000644906.2",
          "protein_id": "ENSP00000496584.2",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 741,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2226,
          "cdna_start": 279,
          "cdna_end": null,
          "cdna_length": 3541,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 17,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.44_94delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val15_Gly31del",
          "transcript": "ENST00000642986.1",
          "protein_id": "ENSP00000494422.1",
          "transcript_support_level": null,
          "aa_start": 15,
          "aa_end": null,
          "aa_length": 737,
          "cds_start": 44,
          "cds_end": null,
          "cds_length": 2214,
          "cdna_start": 499,
          "cdna_end": null,
          "cdna_length": 3298,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "NM_001438874.1",
          "protein_id": "NP_001425803.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 720,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2163,
          "cdna_start": 279,
          "cdna_end": null,
          "cdna_length": 3074,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "NM_001438875.1",
          "protein_id": "NP_001425804.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 720,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2163,
          "cdna_start": 352,
          "cdna_end": null,
          "cdna_length": 3147,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000644138.1",
          "protein_id": "ENSP00000496649.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 702,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2109,
          "cdna_start": 279,
          "cdna_end": null,
          "cdna_length": 2777,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "ENST00000715149.1",
          "protein_id": "ENSP00000520350.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 693,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2082,
          "cdna_start": 313,
          "cdna_end": null,
          "cdna_length": 2406,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "XM_024453356.2",
          "protein_id": "XP_024309124.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 211,
          "cdna_end": null,
          "cdna_length": 3593,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "XM_047447478.1",
          "protein_id": "XP_047303434.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 2111,
          "cdna_end": null,
          "cdna_length": 5493,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "XM_047447479.1",
          "protein_id": "XP_047303435.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 19402,
          "cdna_end": null,
          "cdna_length": 22320,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del",
          "transcript": "XM_047447480.1",
          "protein_id": "XP_047303436.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 781,
          "cds_start": 65,
          "cds_end": null,
          "cds_length": 2346,
          "cdna_start": 2111,
          "cdna_end": null,
          "cdna_length": 5029,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VSHWQQQSYLDSGIHSGA",
          "aa_alt": "A",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "c.44_94delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val15_Gly31del",
          "transcript": "XM_047447482.1",
          "protein_id": "XP_047303438.1",
          "transcript_support_level": null,
          "aa_start": 15,
          "aa_end": null,
          "aa_length": 774,
          "cds_start": 44,
          "cds_end": null,
          "cds_length": 2325,
          "cdna_start": 19534,
          "cdna_end": null,
          "cdna_length": 22916,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "n.284_334delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": null,
          "transcript": "ENST00000488914.2",
          "protein_id": null,
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 558,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "n.297_347delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": null,
          "transcript": "ENST00000643052.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4888,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 12,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "n.181_231delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": null,
          "transcript": "ENST00000643865.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4145,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "n.385_435delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": null,
          "transcript": "ENST00000645305.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3312,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "n.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": null,
          "transcript": "ENST00000646074.1",
          "protein_id": "ENSP00000494263.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3197,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "n.586_636delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": null,
          "transcript": "ENST00000647021.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3472,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "n.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": null,
          "transcript": "ENST00000715150.1",
          "protein_id": "ENSP00000520351.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3210,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "n.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": null,
          "transcript": "ENST00000715153.1",
          "protein_id": "ENSP00000520354.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3347,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "CTNNB1",
          "gene_hgnc_id": 2514,
          "hgvs_c": "n.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": null,
          "transcript": "ENST00000715155.1",
          "protein_id": "ENSP00000520356.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3193,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "CTNNB1",
      "gene_hgnc_id": 2514,
      "dbsnp": "rs121913416",
      "frequency_reference_population": null,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 0,
      "gnomad_exomes_af": null,
      "gnomad_genomes_af": null,
      "gnomad_exomes_ac": null,
      "gnomad_genomes_ac": null,
      "gnomad_exomes_homalt": null,
      "gnomad_genomes_homalt": null,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 10.003,
      "phylop100way_prediction": "Pathogenic",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 3,
      "acmg_classification": "Uncertain_significance",
      "acmg_criteria": "PM4,PP3",
      "acmg_by_gene": [
        {
          "score": 3,
          "benign_score": 0,
          "pathogenic_score": 3,
          "criteria": [
            "PM4",
            "PP3"
          ],
          "verdict": "Uncertain_significance",
          "transcript": "ENST00000349496.11",
          "gene_symbol": "CTNNB1",
          "hgnc_id": 2514,
          "effects": [
            "disruptive_inframe_deletion"
          ],
          "inheritance_mode": "AD,Unknown",
          "hgvs_c": "c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG",
          "hgvs_p": "p.Val22_Gly38del"
        }
      ],
      "clinvar_disease": "",
      "clinvar_classification": "",
      "clinvar_review_status": "",
      "clinvar_submissions_summary": "",
      "phenotype_combined": null,
      "pathogenicity_classification_combined": null,
      "custom_annotations": null
    }
  ],
  "message": null
}