← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 5-37063828-AGAAGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCG-A (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=5&pos=37063828&ref=AGAAGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCG&alt=A&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "5",
"pos": 37063828,
"ref": "AGAAGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCG",
"alt": "A",
"effect": "frameshift_variant",
"transcript": "ENST00000282516.13",
"consequences": [
{
"aa_ref": "EEGEVSASTNARN",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 46,
"exon_rank_end": null,
"exon_count": 47,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NIPBL",
"gene_hgnc_id": 28862,
"hgvs_c": "c.7903_7940delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
"hgvs_p": "p.Glu2635fs",
"transcript": "NM_133433.4",
"protein_id": "NP_597677.2",
"transcript_support_level": null,
"aa_start": 2635,
"aa_end": null,
"aa_length": 2804,
"cds_start": 7903,
"cds_end": null,
"cds_length": 8415,
"cdna_start": 8392,
"cdna_end": null,
"cdna_length": 10425,
"mane_select": "ENST00000282516.13",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EEGEVSASTNARN",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 46,
"exon_rank_end": null,
"exon_count": 47,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NIPBL",
"gene_hgnc_id": 28862,
"hgvs_c": "c.7903_7940delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
"hgvs_p": "p.Glu2635fs",
"transcript": "ENST00000282516.13",
"protein_id": "ENSP00000282516.8",
"transcript_support_level": 1,
"aa_start": 2635,
"aa_end": null,
"aa_length": 2804,
"cds_start": 7903,
"cds_end": null,
"cds_length": 8415,
"cdna_start": 8392,
"cdna_end": null,
"cdna_length": 10425,
"mane_select": "NM_133433.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EEGEVSASTNARN",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 46,
"exon_rank_end": null,
"exon_count": 46,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NIPBL",
"gene_hgnc_id": 28862,
"hgvs_c": "c.7903_7940delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
"hgvs_p": "p.Glu2635fs",
"transcript": "ENST00000448238.2",
"protein_id": "ENSP00000406266.2",
"transcript_support_level": 1,
"aa_start": 2635,
"aa_end": null,
"aa_length": 2697,
"cds_start": 7903,
"cds_end": null,
"cds_length": 8094,
"cdna_start": 8371,
"cdna_end": null,
"cdna_length": 8729,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EEGEVSASTNARN",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 46,
"exon_rank_end": null,
"exon_count": 47,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NIPBL",
"gene_hgnc_id": 28862,
"hgvs_c": "c.7903_7940delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
"hgvs_p": "p.Glu2635fs",
"transcript": "NM_001438586.1",
"protein_id": "NP_001425515.1",
"transcript_support_level": null,
"aa_start": 2635,
"aa_end": null,
"aa_length": 2698,
"cds_start": 7903,
"cds_end": null,
"cds_length": 8097,
"cdna_start": 8392,
"cdna_end": null,
"cdna_length": 10466,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EEGEVSASTNARN",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 46,
"exon_rank_end": null,
"exon_count": 46,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NIPBL",
"gene_hgnc_id": 28862,
"hgvs_c": "c.7903_7940delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
"hgvs_p": "p.Glu2635fs",
"transcript": "NM_015384.5",
"protein_id": "NP_056199.2",
"transcript_support_level": null,
"aa_start": 2635,
"aa_end": null,
"aa_length": 2697,
"cds_start": 7903,
"cds_end": null,
"cds_length": 8094,
"cdna_start": 8392,
"cdna_end": null,
"cdna_length": 10379,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EEGEVSASTNARN",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 45,
"exon_rank_end": null,
"exon_count": 46,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NIPBL",
"gene_hgnc_id": 28862,
"hgvs_c": "c.7756_7793delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
"hgvs_p": "p.Glu2586fs",
"transcript": "ENST00000652901.1",
"protein_id": "ENSP00000499536.1",
"transcript_support_level": null,
"aa_start": 2586,
"aa_end": null,
"aa_length": 2649,
"cds_start": 7756,
"cds_end": null,
"cds_length": 7950,
"cdna_start": 8173,
"cdna_end": null,
"cdna_length": 9228,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "KKKGRFQLAQMLGT",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NIPBL",
"gene_hgnc_id": 28862,
"hgvs_c": "c.306_343delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
"hgvs_p": "p.Lys102fs",
"transcript": "ENST00000513819.1",
"protein_id": "ENSP00000421504.1",
"transcript_support_level": 3,
"aa_start": 102,
"aa_end": null,
"aa_length": 149,
"cds_start": 306,
"cds_end": null,
"cds_length": 452,
"cdna_start": 306,
"cdna_end": null,
"cdna_length": 452,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EEGEVSASTNARN",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 45,
"exon_rank_end": null,
"exon_count": 46,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NIPBL",
"gene_hgnc_id": 28862,
"hgvs_c": "c.7756_7793delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
"hgvs_p": "p.Glu2586fs",
"transcript": "XM_006714467.3",
"protein_id": "XP_006714530.1",
"transcript_support_level": null,
"aa_start": 2586,
"aa_end": null,
"aa_length": 2755,
"cds_start": 7756,
"cds_end": null,
"cds_length": 8268,
"cdna_start": 8245,
"cdna_end": null,
"cdna_length": 10278,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EEGEVSASTNARN",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 45,
"exon_rank_end": null,
"exon_count": 46,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NIPBL",
"gene_hgnc_id": 28862,
"hgvs_c": "c.7705_7742delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
"hgvs_p": "p.Glu2569fs",
"transcript": "XM_006714468.3",
"protein_id": "XP_006714531.1",
"transcript_support_level": null,
"aa_start": 2569,
"aa_end": null,
"aa_length": 2738,
"cds_start": 7705,
"cds_end": null,
"cds_length": 8217,
"cdna_start": 8194,
"cdna_end": null,
"cdna_length": 10227,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EEGEVSASTNARN",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 45,
"exon_rank_end": null,
"exon_count": 46,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NIPBL",
"gene_hgnc_id": 28862,
"hgvs_c": "c.7756_7793delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
"hgvs_p": "p.Glu2586fs",
"transcript": "XM_017009329.2",
"protein_id": "XP_016864818.1",
"transcript_support_level": null,
"aa_start": 2586,
"aa_end": null,
"aa_length": 2649,
"cds_start": 7756,
"cds_end": null,
"cds_length": 7950,
"cdna_start": 8245,
"cdna_end": null,
"cdna_length": 10319,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "EEGEVSASTNARN",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 40,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NIPBL",
"gene_hgnc_id": 28862,
"hgvs_c": "c.7243_7280delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
"hgvs_p": "p.Glu2415fs",
"transcript": "XM_005248282.6",
"protein_id": "XP_005248339.3",
"transcript_support_level": null,
"aa_start": 2415,
"aa_end": null,
"aa_length": 2584,
"cds_start": 7243,
"cds_end": null,
"cds_length": 7755,
"cdna_start": 7947,
"cdna_end": null,
"cdna_length": 9980,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NIPBL",
"gene_hgnc_id": 28862,
"hgvs_c": "n.1785_1822delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
"hgvs_p": null,
"transcript": "ENST00000514335.1",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2948,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "NIPBL",
"gene_hgnc_id": 28862,
"dbsnp": "rs727503771",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 9.602,
"phylop100way_prediction": "Pathogenic",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 9,
"acmg_classification": "Likely_pathogenic",
"acmg_criteria": "PVS1,PP5",
"acmg_by_gene": [
{
"score": 9,
"benign_score": 0,
"pathogenic_score": 9,
"criteria": [
"PVS1",
"PP5"
],
"verdict": "Likely_pathogenic",
"transcript": "ENST00000282516.13",
"gene_symbol": "NIPBL",
"hgnc_id": 28862,
"effects": [
"frameshift_variant"
],
"inheritance_mode": "AD",
"hgvs_c": "c.7903_7940delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
"hgvs_p": "p.Glu2635fs"
}
],
"clinvar_disease": "Cornelia de Lange syndrome 1",
"clinvar_classification": "Pathogenic",
"clinvar_review_status": "no assertion criteria provided",
"clinvar_submissions_summary": "null",
"phenotype_combined": "Cornelia de Lange syndrome 1",
"pathogenicity_classification_combined": "Pathogenic",
"custom_annotations": null
}
],
"message": null
}