← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 5-37063828-AGAAGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCG-A (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=5&pos=37063828&ref=AGAAGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCG&alt=A&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "5",
      "pos": 37063828,
      "ref": "AGAAGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCG",
      "alt": "A",
      "effect": "frameshift_variant",
      "transcript": "ENST00000282516.13",
      "consequences": [
        {
          "aa_ref": "EEGEVSASTNARN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 46,
          "exon_rank_end": null,
          "exon_count": 47,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NIPBL",
          "gene_hgnc_id": 28862,
          "hgvs_c": "c.7903_7940delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
          "hgvs_p": "p.Glu2635fs",
          "transcript": "NM_133433.4",
          "protein_id": "NP_597677.2",
          "transcript_support_level": null,
          "aa_start": 2635,
          "aa_end": null,
          "aa_length": 2804,
          "cds_start": 7903,
          "cds_end": null,
          "cds_length": 8415,
          "cdna_start": 8392,
          "cdna_end": null,
          "cdna_length": 10425,
          "mane_select": "ENST00000282516.13",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EEGEVSASTNARN",
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 46,
          "exon_rank_end": null,
          "exon_count": 47,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NIPBL",
          "gene_hgnc_id": 28862,
          "hgvs_c": "c.7903_7940delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
          "hgvs_p": "p.Glu2635fs",
          "transcript": "ENST00000282516.13",
          "protein_id": "ENSP00000282516.8",
          "transcript_support_level": 1,
          "aa_start": 2635,
          "aa_end": null,
          "aa_length": 2804,
          "cds_start": 7903,
          "cds_end": null,
          "cds_length": 8415,
          "cdna_start": 8392,
          "cdna_end": null,
          "cdna_length": 10425,
          "mane_select": "NM_133433.4",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EEGEVSASTNARN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 46,
          "exon_rank_end": null,
          "exon_count": 46,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NIPBL",
          "gene_hgnc_id": 28862,
          "hgvs_c": "c.7903_7940delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
          "hgvs_p": "p.Glu2635fs",
          "transcript": "ENST00000448238.2",
          "protein_id": "ENSP00000406266.2",
          "transcript_support_level": 1,
          "aa_start": 2635,
          "aa_end": null,
          "aa_length": 2697,
          "cds_start": 7903,
          "cds_end": null,
          "cds_length": 8094,
          "cdna_start": 8371,
          "cdna_end": null,
          "cdna_length": 8729,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EEGEVSASTNARN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 46,
          "exon_rank_end": null,
          "exon_count": 47,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NIPBL",
          "gene_hgnc_id": 28862,
          "hgvs_c": "c.7903_7940delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
          "hgvs_p": "p.Glu2635fs",
          "transcript": "NM_001438586.1",
          "protein_id": "NP_001425515.1",
          "transcript_support_level": null,
          "aa_start": 2635,
          "aa_end": null,
          "aa_length": 2698,
          "cds_start": 7903,
          "cds_end": null,
          "cds_length": 8097,
          "cdna_start": 8392,
          "cdna_end": null,
          "cdna_length": 10466,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EEGEVSASTNARN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 46,
          "exon_rank_end": null,
          "exon_count": 46,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NIPBL",
          "gene_hgnc_id": 28862,
          "hgvs_c": "c.7903_7940delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
          "hgvs_p": "p.Glu2635fs",
          "transcript": "NM_015384.5",
          "protein_id": "NP_056199.2",
          "transcript_support_level": null,
          "aa_start": 2635,
          "aa_end": null,
          "aa_length": 2697,
          "cds_start": 7903,
          "cds_end": null,
          "cds_length": 8094,
          "cdna_start": 8392,
          "cdna_end": null,
          "cdna_length": 10379,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EEGEVSASTNARN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 45,
          "exon_rank_end": null,
          "exon_count": 46,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NIPBL",
          "gene_hgnc_id": 28862,
          "hgvs_c": "c.7756_7793delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
          "hgvs_p": "p.Glu2586fs",
          "transcript": "ENST00000652901.1",
          "protein_id": "ENSP00000499536.1",
          "transcript_support_level": null,
          "aa_start": 2586,
          "aa_end": null,
          "aa_length": 2649,
          "cds_start": 7756,
          "cds_end": null,
          "cds_length": 7950,
          "cdna_start": 8173,
          "cdna_end": null,
          "cdna_length": 9228,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "KKKGRFQLAQMLGT",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 2,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NIPBL",
          "gene_hgnc_id": 28862,
          "hgvs_c": "c.306_343delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
          "hgvs_p": "p.Lys102fs",
          "transcript": "ENST00000513819.1",
          "protein_id": "ENSP00000421504.1",
          "transcript_support_level": 3,
          "aa_start": 102,
          "aa_end": null,
          "aa_length": 149,
          "cds_start": 306,
          "cds_end": null,
          "cds_length": 452,
          "cdna_start": 306,
          "cdna_end": null,
          "cdna_length": 452,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EEGEVSASTNARN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 45,
          "exon_rank_end": null,
          "exon_count": 46,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NIPBL",
          "gene_hgnc_id": 28862,
          "hgvs_c": "c.7756_7793delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
          "hgvs_p": "p.Glu2586fs",
          "transcript": "XM_006714467.3",
          "protein_id": "XP_006714530.1",
          "transcript_support_level": null,
          "aa_start": 2586,
          "aa_end": null,
          "aa_length": 2755,
          "cds_start": 7756,
          "cds_end": null,
          "cds_length": 8268,
          "cdna_start": 8245,
          "cdna_end": null,
          "cdna_length": 10278,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EEGEVSASTNARN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 45,
          "exon_rank_end": null,
          "exon_count": 46,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NIPBL",
          "gene_hgnc_id": 28862,
          "hgvs_c": "c.7705_7742delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
          "hgvs_p": "p.Glu2569fs",
          "transcript": "XM_006714468.3",
          "protein_id": "XP_006714531.1",
          "transcript_support_level": null,
          "aa_start": 2569,
          "aa_end": null,
          "aa_length": 2738,
          "cds_start": 7705,
          "cds_end": null,
          "cds_length": 8217,
          "cdna_start": 8194,
          "cdna_end": null,
          "cdna_length": 10227,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EEGEVSASTNARN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 45,
          "exon_rank_end": null,
          "exon_count": 46,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NIPBL",
          "gene_hgnc_id": 28862,
          "hgvs_c": "c.7756_7793delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
          "hgvs_p": "p.Glu2586fs",
          "transcript": "XM_017009329.2",
          "protein_id": "XP_016864818.1",
          "transcript_support_level": null,
          "aa_start": 2586,
          "aa_end": null,
          "aa_length": 2649,
          "cds_start": 7756,
          "cds_end": null,
          "cds_length": 7950,
          "cdna_start": 8245,
          "cdna_end": null,
          "cdna_length": 10319,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EEGEVSASTNARN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 40,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NIPBL",
          "gene_hgnc_id": 28862,
          "hgvs_c": "c.7243_7280delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
          "hgvs_p": "p.Glu2415fs",
          "transcript": "XM_005248282.6",
          "protein_id": "XP_005248339.3",
          "transcript_support_level": null,
          "aa_start": 2415,
          "aa_end": null,
          "aa_length": 2584,
          "cds_start": 7243,
          "cds_end": null,
          "cds_length": 7755,
          "cdna_start": 7947,
          "cdna_end": null,
          "cdna_length": 9980,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NIPBL",
          "gene_hgnc_id": 28862,
          "hgvs_c": "n.1785_1822delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
          "hgvs_p": null,
          "transcript": "ENST00000514335.1",
          "protein_id": null,
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2948,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "NIPBL",
      "gene_hgnc_id": 28862,
      "dbsnp": "rs727503771",
      "frequency_reference_population": null,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 0,
      "gnomad_exomes_af": null,
      "gnomad_genomes_af": null,
      "gnomad_exomes_ac": null,
      "gnomad_genomes_ac": null,
      "gnomad_exomes_homalt": null,
      "gnomad_genomes_homalt": null,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 9.602,
      "phylop100way_prediction": "Pathogenic",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 9,
      "acmg_classification": "Likely_pathogenic",
      "acmg_criteria": "PVS1,PP5",
      "acmg_by_gene": [
        {
          "score": 9,
          "benign_score": 0,
          "pathogenic_score": 9,
          "criteria": [
            "PVS1",
            "PP5"
          ],
          "verdict": "Likely_pathogenic",
          "transcript": "ENST00000282516.13",
          "gene_symbol": "NIPBL",
          "hgnc_id": 28862,
          "effects": [
            "frameshift_variant"
          ],
          "inheritance_mode": "AD",
          "hgvs_c": "c.7903_7940delGAAGAAGGGGAGGTTTCAGCTAGCACAAATGCTCGGAA",
          "hgvs_p": "p.Glu2635fs"
        }
      ],
      "clinvar_disease": "Cornelia de Lange syndrome 1",
      "clinvar_classification": "Pathogenic",
      "clinvar_review_status": "no assertion criteria provided",
      "clinvar_submissions_summary": "null",
      "phenotype_combined": "Cornelia de Lange syndrome 1",
      "pathogenicity_classification_combined": "Pathogenic",
      "custom_annotations": null
    }
  ],
  "message": null
}