← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 5-80654344-C-CTCGCGCGTCCCGCCCAGGT (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=5&pos=80654344&ref=C&alt=CTCGCGCGTCCCGCCCAGGT&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "5",
      "pos": 80654344,
      "ref": "C",
      "alt": "CTCGCGCGTCCCGCCCAGGT",
      "effect": "intron_variant",
      "transcript": "ENST00000439211.7",
      "consequences": [
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "DHFR",
          "gene_hgnc_id": 2861,
          "hgvs_c": "c.86+59_86+60insACCTGGGCGGGACGCGCGA",
          "hgvs_p": null,
          "transcript": "NM_000791.4",
          "protein_id": "NP_000782.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 187,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 564,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3919,
          "mane_select": "ENST00000439211.7",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "DHFR",
          "gene_hgnc_id": 2861,
          "hgvs_c": "c.86+59_86+60insACCTGGGCGGGACGCGCGA",
          "hgvs_p": null,
          "transcript": "ENST00000439211.7",
          "protein_id": "ENSP00000396308.2",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 187,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 564,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3919,
          "mane_select": "NM_000791.4",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "DHFR",
          "gene_hgnc_id": 2861,
          "hgvs_c": "n.144+59_144+60insACCTGGGCGGGACGCGCGA",
          "hgvs_p": null,
          "transcript": "ENST00000513048.5",
          "protein_id": null,
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 994,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "DHFR",
          "gene_hgnc_id": 2861,
          "hgvs_c": "c.86+59_86+60insACCTGGGCGGGACGCGCGA",
          "hgvs_p": null,
          "transcript": "ENST00000505337.5",
          "protein_id": "ENSP00000426474.1",
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 187,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 564,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1719,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "DHFR",
          "gene_hgnc_id": 2861,
          "hgvs_c": "c.-21+59_-21+60insACCTGGGCGGGACGCGCGA",
          "hgvs_p": null,
          "transcript": "NM_001290354.2",
          "protein_id": "NP_001277283.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 135,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 408,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3869,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "DHFR",
          "gene_hgnc_id": 2861,
          "hgvs_c": "c.-21+59_-21+60insACCTGGGCGGGACGCGCGA",
          "hgvs_p": null,
          "transcript": "ENST00000504396.1",
          "protein_id": "ENSP00000421334.1",
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 135,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 408,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1447,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "DHFR",
          "gene_hgnc_id": 2861,
          "hgvs_c": "c.86+59_86+60insACCTGGGCGGGACGCGCGA",
          "hgvs_p": null,
          "transcript": "NM_001290357.2",
          "protein_id": "NP_001277286.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 129,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 390,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3803,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "DHFR",
          "gene_hgnc_id": 2861,
          "hgvs_c": "c.86+59_86+60insACCTGGGCGGGACGCGCGA",
          "hgvs_p": null,
          "transcript": "ENST00000511032.5",
          "protein_id": "ENSP00000422732.1",
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 129,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 390,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1474,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "DHFR",
          "gene_hgnc_id": 2861,
          "hgvs_c": "n.580+59_580+60insACCTGGGCGGGACGCGCGA",
          "hgvs_p": null,
          "transcript": "NR_110936.2",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3742,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "upstream_gene_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "DHFR",
          "gene_hgnc_id": 2861,
          "hgvs_c": "n.-244_-243insACCTGGGCGGGACGCGCGA",
          "hgvs_p": null,
          "transcript": "ENST00000508282.1",
          "protein_id": null,
          "transcript_support_level": 3,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 545,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "DHFR",
      "gene_hgnc_id": 2861,
      "dbsnp": "rs70991108",
      "frequency_reference_population": 0.000010839901,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 17,
      "gnomad_exomes_af": 0.00000776687,
      "gnomad_genomes_af": 0.0000394716,
      "gnomad_exomes_ac": 11,
      "gnomad_genomes_ac": 6,
      "gnomad_exomes_homalt": 0,
      "gnomad_genomes_homalt": 0,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": -0.762,
      "phylop100way_prediction": "Benign",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 0,
      "acmg_classification": "Uncertain_significance",
      "acmg_criteria": "",
      "acmg_by_gene": [
        {
          "score": 0,
          "benign_score": 0,
          "pathogenic_score": 0,
          "criteria": [],
          "verdict": "Uncertain_significance",
          "transcript": "ENST00000439211.7",
          "gene_symbol": "DHFR",
          "hgnc_id": 2861,
          "effects": [
            "intron_variant"
          ],
          "inheritance_mode": "AR",
          "hgvs_c": "c.86+59_86+60insACCTGGGCGGGACGCGCGA",
          "hgvs_p": null
        }
      ],
      "clinvar_disease": "",
      "clinvar_classification": "",
      "clinvar_review_status": "",
      "clinvar_submissions_summary": "",
      "phenotype_combined": null,
      "pathogenicity_classification_combined": null,
      "custom_annotations": null
    }
  ],
  "message": null
}