← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 5-80654344-C-CTCGCGCGTCCCGCCCAGGT (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=5&pos=80654344&ref=C&alt=CTCGCGCGTCCCGCCCAGGT&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "5",
"pos": 80654344,
"ref": "C",
"alt": "CTCGCGCGTCCCGCCCAGGT",
"effect": "intron_variant",
"transcript": "ENST00000439211.7",
"consequences": [
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "DHFR",
"gene_hgnc_id": 2861,
"hgvs_c": "c.86+59_86+60insACCTGGGCGGGACGCGCGA",
"hgvs_p": null,
"transcript": "NM_000791.4",
"protein_id": "NP_000782.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 187,
"cds_start": -4,
"cds_end": null,
"cds_length": 564,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3919,
"mane_select": "ENST00000439211.7",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "DHFR",
"gene_hgnc_id": 2861,
"hgvs_c": "c.86+59_86+60insACCTGGGCGGGACGCGCGA",
"hgvs_p": null,
"transcript": "ENST00000439211.7",
"protein_id": "ENSP00000396308.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 187,
"cds_start": -4,
"cds_end": null,
"cds_length": 564,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3919,
"mane_select": "NM_000791.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "DHFR",
"gene_hgnc_id": 2861,
"hgvs_c": "n.144+59_144+60insACCTGGGCGGGACGCGCGA",
"hgvs_p": null,
"transcript": "ENST00000513048.5",
"protein_id": null,
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 994,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "DHFR",
"gene_hgnc_id": 2861,
"hgvs_c": "c.86+59_86+60insACCTGGGCGGGACGCGCGA",
"hgvs_p": null,
"transcript": "ENST00000505337.5",
"protein_id": "ENSP00000426474.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 187,
"cds_start": -4,
"cds_end": null,
"cds_length": 564,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1719,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "DHFR",
"gene_hgnc_id": 2861,
"hgvs_c": "c.-21+59_-21+60insACCTGGGCGGGACGCGCGA",
"hgvs_p": null,
"transcript": "NM_001290354.2",
"protein_id": "NP_001277283.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 135,
"cds_start": -4,
"cds_end": null,
"cds_length": 408,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3869,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "DHFR",
"gene_hgnc_id": 2861,
"hgvs_c": "c.-21+59_-21+60insACCTGGGCGGGACGCGCGA",
"hgvs_p": null,
"transcript": "ENST00000504396.1",
"protein_id": "ENSP00000421334.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 135,
"cds_start": -4,
"cds_end": null,
"cds_length": 408,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1447,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "DHFR",
"gene_hgnc_id": 2861,
"hgvs_c": "c.86+59_86+60insACCTGGGCGGGACGCGCGA",
"hgvs_p": null,
"transcript": "NM_001290357.2",
"protein_id": "NP_001277286.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 129,
"cds_start": -4,
"cds_end": null,
"cds_length": 390,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3803,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "DHFR",
"gene_hgnc_id": 2861,
"hgvs_c": "c.86+59_86+60insACCTGGGCGGGACGCGCGA",
"hgvs_p": null,
"transcript": "ENST00000511032.5",
"protein_id": "ENSP00000422732.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 129,
"cds_start": -4,
"cds_end": null,
"cds_length": 390,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1474,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "DHFR",
"gene_hgnc_id": 2861,
"hgvs_c": "n.580+59_580+60insACCTGGGCGGGACGCGCGA",
"hgvs_p": null,
"transcript": "NR_110936.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3742,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "DHFR",
"gene_hgnc_id": 2861,
"hgvs_c": "n.-244_-243insACCTGGGCGGGACGCGCGA",
"hgvs_p": null,
"transcript": "ENST00000508282.1",
"protein_id": null,
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 545,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "DHFR",
"gene_hgnc_id": 2861,
"dbsnp": "rs70991108",
"frequency_reference_population": 0.000010839901,
"hom_count_reference_population": 0,
"allele_count_reference_population": 17,
"gnomad_exomes_af": 0.00000776687,
"gnomad_genomes_af": 0.0000394716,
"gnomad_exomes_ac": 11,
"gnomad_genomes_ac": 6,
"gnomad_exomes_homalt": 0,
"gnomad_genomes_homalt": 0,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": -0.762,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 0,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "",
"acmg_by_gene": [
{
"score": 0,
"benign_score": 0,
"pathogenic_score": 0,
"criteria": [],
"verdict": "Uncertain_significance",
"transcript": "ENST00000439211.7",
"gene_symbol": "DHFR",
"hgnc_id": 2861,
"effects": [
"intron_variant"
],
"inheritance_mode": "AR",
"hgvs_c": "c.86+59_86+60insACCTGGGCGGGACGCGCGA",
"hgvs_p": null
}
],
"clinvar_disease": "",
"clinvar_classification": "",
"clinvar_review_status": "",
"clinvar_submissions_summary": "",
"phenotype_combined": null,
"pathogenicity_classification_combined": null,
"custom_annotations": null
}
],
"message": null
}