← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAGCAG-A (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=6&pos=170561958&ref=ACAGCAGCAGCAGCAGCAGCAGCAGCAG&alt=A&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "6",
"pos": 170561958,
"ref": "ACAGCAGCAGCAGCAGCAGCAGCAGCAG",
"alt": "A",
"effect": "disruptive_inframe_deletion",
"transcript": "ENST00000392092.7",
"consequences": [
{
"aa_ref": "QQQQQQQQQQ",
"aa_alt": "Q",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TBP",
"gene_hgnc_id": 11588,
"hgvs_c": "c.255_281delGCAGCAGCAGCAGCAGCAGCAGCAGCA",
"hgvs_p": "p.Gln86_Gln94del",
"transcript": "NM_003194.5",
"protein_id": "NP_003185.1",
"transcript_support_level": null,
"aa_start": 85,
"aa_end": null,
"aa_length": 339,
"cds_start": 255,
"cds_end": null,
"cds_length": 1020,
"cdna_start": 498,
"cdna_end": null,
"cdna_length": 1857,
"mane_select": "ENST00000392092.7",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "QQQQQQQQQQ",
"aa_alt": "Q",
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TBP",
"gene_hgnc_id": 11588,
"hgvs_c": "c.255_281delGCAGCAGCAGCAGCAGCAGCAGCAGCA",
"hgvs_p": "p.Gln86_Gln94del",
"transcript": "ENST00000392092.7",
"protein_id": "ENSP00000375942.2",
"transcript_support_level": 1,
"aa_start": 85,
"aa_end": null,
"aa_length": 339,
"cds_start": 255,
"cds_end": null,
"cds_length": 1020,
"cdna_start": 498,
"cdna_end": null,
"cdna_length": 1857,
"mane_select": "NM_003194.5",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "QQQQQQQQQQ",
"aa_alt": "Q",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TBP",
"gene_hgnc_id": 11588,
"hgvs_c": "c.255_281delGCAGCAGCAGCAGCAGCAGCAGCAGCA",
"hgvs_p": "p.Gln86_Gln94del",
"transcript": "ENST00000230354.10",
"protein_id": "ENSP00000230354.5",
"transcript_support_level": 1,
"aa_start": 85,
"aa_end": null,
"aa_length": 339,
"cds_start": 255,
"cds_end": null,
"cds_length": 1020,
"cdna_start": 491,
"cdna_end": null,
"cdna_length": 1861,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "QQQQQQQQQQ",
"aa_alt": "Q",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TBP",
"gene_hgnc_id": 11588,
"hgvs_c": "c.255_281delGCAGCAGCAGCAGCAGCAGCAGCAGCA",
"hgvs_p": "p.Gln86_Gln94del",
"transcript": "ENST00000421512.5",
"protein_id": "ENSP00000400008.1",
"transcript_support_level": 1,
"aa_start": 85,
"aa_end": null,
"aa_length": 207,
"cds_start": 255,
"cds_end": null,
"cds_length": 625,
"cdna_start": 565,
"cdna_end": null,
"cdna_length": 935,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "QQQQQQQQQQ",
"aa_alt": "Q",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TBP",
"gene_hgnc_id": 11588,
"hgvs_c": "c.195_221delGCAGCAGCAGCAGCAGCAGCAGCAGCA",
"hgvs_p": "p.Gln66_Gln74del",
"transcript": "NM_001172085.2",
"protein_id": "NP_001165556.1",
"transcript_support_level": null,
"aa_start": 65,
"aa_end": null,
"aa_length": 319,
"cds_start": 195,
"cds_end": null,
"cds_length": 960,
"cdna_start": 296,
"cdna_end": null,
"cdna_length": 1655,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "QQQQQQQQQQ",
"aa_alt": "Q",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TBP",
"gene_hgnc_id": 11588,
"hgvs_c": "c.195_221delGCAGCAGCAGCAGCAGCAGCAGCAGCA",
"hgvs_p": "p.Gln66_Gln74del",
"transcript": "ENST00000540980.5",
"protein_id": "ENSP00000442132.1",
"transcript_support_level": 2,
"aa_start": 65,
"aa_end": null,
"aa_length": 319,
"cds_start": 195,
"cds_end": null,
"cds_length": 960,
"cdna_start": 332,
"cdna_end": null,
"cdna_length": 1701,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "QQQQQQQQQQ",
"aa_alt": "Q",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TBP",
"gene_hgnc_id": 11588,
"hgvs_c": "c.255_281delGCAGCAGCAGCAGCAGCAGCAGCAGCA",
"hgvs_p": "p.Gln86_Gln94del",
"transcript": "ENST00000423353.1",
"protein_id": "ENSP00000416482.1",
"transcript_support_level": 3,
"aa_start": 85,
"aa_end": null,
"aa_length": 149,
"cds_start": 255,
"cds_end": null,
"cds_length": 452,
"cdna_start": 506,
"cdna_end": null,
"cdna_length": 703,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TBP",
"gene_hgnc_id": 11588,
"hgvs_c": "n.255_281delGCAGCAGCAGCAGCAGCAGCAGCAGCA",
"hgvs_p": null,
"transcript": "ENST00000636632.1",
"protein_id": "ENSP00000490461.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1955,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "TBP",
"gene_hgnc_id": 11588,
"dbsnp": "rs752404282",
"frequency_reference_population": 0.0010668751,
"hom_count_reference_population": 6,
"allele_count_reference_population": 1499,
"gnomad_exomes_af": 0.00105821,
"gnomad_genomes_af": 0.0011431,
"gnomad_exomes_ac": 1335,
"gnomad_genomes_ac": 164,
"gnomad_exomes_homalt": 6,
"gnomad_genomes_homalt": 0,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 5.032,
"phylop100way_prediction": "Uncertain_significance",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": -7,
"acmg_classification": "Benign",
"acmg_criteria": "BP3,BP6_Moderate,BS2",
"acmg_by_gene": [
{
"score": -7,
"benign_score": 7,
"pathogenic_score": 0,
"criteria": [
"BP3",
"BP6_Moderate",
"BS2"
],
"verdict": "Benign",
"transcript": "ENST00000392092.7",
"gene_symbol": "TBP",
"hgnc_id": 11588,
"effects": [
"disruptive_inframe_deletion"
],
"inheritance_mode": "AD",
"hgvs_c": "c.255_281delGCAGCAGCAGCAGCAGCAGCAGCAGCA",
"hgvs_p": "p.Gln86_Gln94del"
}
],
"clinvar_disease": "not provided",
"clinvar_classification": "Benign",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "B:1",
"phenotype_combined": "not provided",
"pathogenicity_classification_combined": "Benign",
"custom_annotations": null
}
],
"message": null
}