← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 7-155803415-CCGAGCCCGAGGACGCCTCGGGCT-C (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=7&pos=155803415&ref=CCGAGCCCGAGGACGCCTCGGGCT&alt=C&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "7",
      "pos": 155803415,
      "ref": "CCGAGCCCGAGGACGCCTCGGGCT",
      "alt": "C",
      "effect": "frameshift_variant",
      "transcript": "ENST00000297261.7",
      "consequences": [
        {
          "aa_ref": "EPEASSGS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 3,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "SHH",
          "gene_hgnc_id": 10848,
          "hgvs_c": "c.851_873delAGCCCGAGGCGTCCTCGGGCTCG",
          "hgvs_p": "p.Glu284fs",
          "transcript": "NM_000193.4",
          "protein_id": "NP_000184.1",
          "transcript_support_level": null,
          "aa_start": 284,
          "aa_end": null,
          "aa_length": 462,
          "cds_start": 851,
          "cds_end": null,
          "cds_length": 1389,
          "cdna_start": 1214,
          "cdna_end": null,
          "cdna_length": 4650,
          "mane_select": "ENST00000297261.7",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EPEASSGS",
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 3,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "SHH",
          "gene_hgnc_id": 10848,
          "hgvs_c": "c.851_873delAGCCCGAGGCGTCCTCGGGCTCG",
          "hgvs_p": "p.Glu284fs",
          "transcript": "ENST00000297261.7",
          "protein_id": "ENSP00000297261.2",
          "transcript_support_level": 1,
          "aa_start": 284,
          "aa_end": null,
          "aa_length": 462,
          "cds_start": 851,
          "cds_end": null,
          "cds_length": 1389,
          "cdna_start": 1214,
          "cdna_end": null,
          "cdna_length": 4650,
          "mane_select": "NM_000193.4",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "SHH",
          "gene_hgnc_id": 10848,
          "hgvs_c": "c.301+2858_301+2880delAGCCCGAGGCGTCCTCGGGCTCG",
          "hgvs_p": null,
          "transcript": "ENST00000430104.5",
          "protein_id": "ENSP00000396621.1",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 168,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 507,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 677,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "SHH",
          "gene_hgnc_id": 10848,
          "hgvs_c": "n.302-2841_302-2819delAGCCCGAGGCGTCCTCGGGCTCG",
          "hgvs_p": null,
          "transcript": "ENST00000435425.1",
          "protein_id": "ENSP00000413871.1",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 807,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "SHH",
          "gene_hgnc_id": 10848,
          "hgvs_c": "n.302-2771_302-2749delAGCCCGAGGCGTCCTCGGGCTCG",
          "hgvs_p": null,
          "transcript": "ENST00000441114.5",
          "protein_id": "ENSP00000410546.1",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 888,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EPEASSGS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "SHH",
          "gene_hgnc_id": 10848,
          "hgvs_c": "c.590_612delAGCCCGAGGCGTCCTCGGGCTCG",
          "hgvs_p": "p.Glu197fs",
          "transcript": "XM_011516479.3",
          "protein_id": "XP_011514781.1",
          "transcript_support_level": null,
          "aa_start": 197,
          "aa_end": null,
          "aa_length": 375,
          "cds_start": 590,
          "cds_end": null,
          "cds_length": 1128,
          "cdna_start": 873,
          "cdna_end": null,
          "cdna_length": 4309,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EPEASSGS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "SHH",
          "gene_hgnc_id": 10848,
          "hgvs_c": "c.590_612delAGCCCGAGGCGTCCTCGGGCTCG",
          "hgvs_p": "p.Glu197fs",
          "transcript": "XM_011516480.3",
          "protein_id": "XP_011514782.1",
          "transcript_support_level": null,
          "aa_start": 197,
          "aa_end": null,
          "aa_length": 375,
          "cds_start": 590,
          "cds_end": null,
          "cds_length": 1128,
          "cdna_start": 1171,
          "cdna_end": null,
          "cdna_length": 4607,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "EPEASSGS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 3,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "SHH",
          "gene_hgnc_id": 10848,
          "hgvs_c": "c.512_534delAGCCCGAGGCGTCCTCGGGCTCG",
          "hgvs_p": "p.Glu171fs",
          "transcript": "XM_047420718.1",
          "protein_id": "XP_047276674.1",
          "transcript_support_level": null,
          "aa_start": 171,
          "aa_end": null,
          "aa_length": 349,
          "cds_start": 512,
          "cds_end": null,
          "cds_length": 1050,
          "cdna_start": 744,
          "cdna_end": null,
          "cdna_length": 4180,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "SHH",
          "gene_hgnc_id": 10848,
          "hgvs_c": "c.301+2858_301+2880delAGCCCGAGGCGTCCTCGGGCTCG",
          "hgvs_p": null,
          "transcript": "NM_001310462.2",
          "protein_id": "NP_001297391.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 179,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 540,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 828,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "SHH",
          "gene_hgnc_id": 10848,
          "hgvs_c": "n.563-2771_563-2749delAGCCCGAGGCGTCCTCGGGCTCG",
          "hgvs_p": null,
          "transcript": "NR_132318.2",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1038,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "SHH",
          "gene_hgnc_id": 10848,
          "hgvs_c": "n.563-2841_563-2819delAGCCCGAGGCGTCCTCGGGCTCG",
          "hgvs_p": null,
          "transcript": "NR_132319.2",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 968,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "SHH",
      "gene_hgnc_id": 10848,
      "dbsnp": "rs1554493810",
      "frequency_reference_population": null,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 0,
      "gnomad_exomes_af": null,
      "gnomad_genomes_af": null,
      "gnomad_exomes_ac": null,
      "gnomad_genomes_ac": null,
      "gnomad_exomes_homalt": null,
      "gnomad_genomes_homalt": null,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 2.695,
      "phylop100way_prediction": "Benign",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 10,
      "acmg_classification": "Pathogenic",
      "acmg_criteria": "PVS1,PP5_Moderate",
      "acmg_by_gene": [
        {
          "score": 10,
          "benign_score": 0,
          "pathogenic_score": 10,
          "criteria": [
            "PVS1",
            "PP5_Moderate"
          ],
          "verdict": "Pathogenic",
          "transcript": "ENST00000297261.7",
          "gene_symbol": "SHH",
          "hgnc_id": 10848,
          "effects": [
            "frameshift_variant"
          ],
          "inheritance_mode": "AD,AR",
          "hgvs_c": "c.851_873delAGCCCGAGGCGTCCTCGGGCTCG",
          "hgvs_p": "p.Glu284fs"
        }
      ],
      "clinvar_disease": "Holoprosencephaly 3",
      "clinvar_classification": "Pathogenic",
      "clinvar_review_status": "criteria provided, single submitter",
      "clinvar_submissions_summary": "P:1",
      "phenotype_combined": "Holoprosencephaly 3",
      "pathogenicity_classification_combined": "Pathogenic",
      "custom_annotations": null
    }
  ],
  "message": null
}