← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 7-97872310-T-TGGCGCGGGGCGCAGGGCGCGGGGCGCAGGGCGCGGGGCGCAG (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=7&pos=97872310&ref=T&alt=TGGCGCGGGGCGCAGGGCGCGGGGCGCAGGGCGCGGGGCGCAG&genome=hg38&allGenes=true"

API Response

json
{
  "message": null,
  "variants": [
    {
      "acmg_by_gene": [
        {
          "benign_score": 0,
          "criteria": [],
          "effects": [
            "intron_variant"
          ],
          "gene_symbol": "ASNS",
          "hgnc_id": 753,
          "hgvs_c": "c.-60+40_-60+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "inheritance_mode": "AR",
          "pathogenic_score": 0,
          "score": 0,
          "transcript": "NM_001673.5",
          "verdict": "Uncertain_significance"
        },
        {
          "benign_score": 0,
          "criteria": [],
          "effects": [
            "non_coding_transcript_exon_variant"
          ],
          "gene_symbol": "ENSG00000297732",
          "hgnc_id": null,
          "hgvs_c": "n.123_124insGCGGGGCGCAGGGCGCGGGGCGCAGGGCGCGGGGCGCAGGGC",
          "hgvs_p": null,
          "inheritance_mode": "",
          "pathogenic_score": 0,
          "score": 0,
          "transcript": "ENST00000750621.1",
          "verdict": "Uncertain_significance"
        },
        {
          "benign_score": 0,
          "criteria": [],
          "effects": [
            "intron_variant"
          ],
          "gene_symbol": "CZ1P-ASNS",
          "hgnc_id": null,
          "hgvs_c": "n.1571-2498_1571-2497insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "inheritance_mode": "",
          "pathogenic_score": 0,
          "score": 0,
          "transcript": "NR_147989.1",
          "verdict": "Uncertain_significance"
        },
        {
          "benign_score": 0,
          "criteria": [],
          "effects": [
            "intron_variant"
          ],
          "gene_symbol": "ENSG00000284707",
          "hgnc_id": null,
          "hgvs_c": "n.331-3235_331-3234insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "inheritance_mode": "",
          "pathogenic_score": 0,
          "score": 0,
          "transcript": "ENST00000641315.1",
          "verdict": "Uncertain_significance"
        }
      ],
      "acmg_classification": "Uncertain_significance",
      "acmg_criteria": "",
      "acmg_score": 0,
      "allele_count_reference_population": null,
      "alphamissense_prediction": null,
      "alphamissense_score": null,
      "alt": "TGGCGCGGGGCGCAGGGCGCGGGGCGCAGGGCGCGGGGCGCAG",
      "apogee2_prediction": null,
      "apogee2_score": null,
      "bayesdelnoaf_prediction": null,
      "bayesdelnoaf_score": null,
      "chr": "7",
      "clinvar_classification": "",
      "clinvar_disease": "",
      "clinvar_review_status": "",
      "clinvar_submissions_summary": "",
      "computational_prediction_selected": null,
      "computational_score_selected": null,
      "computational_source_selected": null,
      "consequences": [
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 561,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 2385,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1686,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 13,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "NM_001673.5",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-60+40_-60+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": "ENST00000394308.8",
          "protein_coding": true,
          "protein_id": "NP_001664.3",
          "strand": false,
          "transcript": "NM_001673.5",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 561,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": true,
          "cdna_end": null,
          "cdna_length": 2385,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1686,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 13,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000394308.8",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-60+40_-60+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": "NM_001673.5",
          "protein_coding": true,
          "protein_id": "ENSP00000377845.3",
          "strand": false,
          "transcript": "ENST00000394308.8",
          "transcript_support_level": 1
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 561,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 2356,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1686,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 14,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000175506.8",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-338+40_-338+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000175506.4",
          "strand": false,
          "transcript": "ENST00000175506.8",
          "transcript_support_level": 1
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 577,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 1980,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1734,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 13,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000931349.1",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-60+40_-60+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000601408.1",
          "strand": false,
          "transcript": "ENST00000931349.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 562,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 1979,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1689,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 13,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000884569.1",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-60+40_-60+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000554628.1",
          "strand": false,
          "transcript": "ENST00000884569.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 561,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 2786,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1686,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 14,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "NM_001352496.2",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-60+40_-60+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 2,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "NP_001339425.1",
          "strand": false,
          "transcript": "NM_001352496.2",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 561,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 2663,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1686,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 14,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "NM_183356.4",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-338+40_-338+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "NP_899199.2",
          "strand": false,
          "transcript": "NM_183356.4",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 561,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 1975,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1686,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 12,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000884568.1",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-24+40_-24+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000554627.1",
          "strand": false,
          "transcript": "ENST00000884568.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 561,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 1978,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1686,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 13,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000931343.1",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-60+132_-60+133insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000601402.1",
          "strand": false,
          "transcript": "ENST00000931343.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 561,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 2004,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1686,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 13,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000931345.1",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-56+40_-56+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000601404.1",
          "strand": false,
          "transcript": "ENST00000931345.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 561,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 2031,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1686,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 13,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000931346.1",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-96+40_-96+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000601405.1",
          "strand": false,
          "transcript": "ENST00000931346.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 561,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 2587,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1686,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 12,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000968225.1",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-658+40_-658+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000638284.1",
          "strand": false,
          "transcript": "ENST00000968225.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 558,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 2006,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1677,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 13,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000931344.1",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-60+40_-60+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000601403.1",
          "strand": false,
          "transcript": "ENST00000931344.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 540,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 2311,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1623,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 13,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "NM_001178075.2",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-49+40_-49+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "NP_001171546.1",
          "strand": false,
          "transcript": "NM_001178075.2",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 540,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 1865,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1623,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 12,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000422745.5",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-13+40_-13+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000414901.1",
          "strand": false,
          "transcript": "ENST00000422745.5",
          "transcript_support_level": 5
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 540,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 1812,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1623,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 13,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000444334.5",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-49+40_-49+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000406994.1",
          "strand": false,
          "transcript": "ENST00000444334.5",
          "transcript_support_level": 2
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 496,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 1772,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1491,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 13,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000968226.1",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-60+40_-60+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000638285.1",
          "strand": false,
          "transcript": "ENST00000968226.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 478,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 2077,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1437,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 11,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "NM_001178076.2",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-1+40_-1+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "NP_001171547.1",
          "strand": false,
          "transcript": "NM_001178076.2",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 478,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 1588,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1437,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 11,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000455086.5",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-1+40_-1+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000408472.1",
          "strand": false,
          "transcript": "ENST00000455086.5",
          "transcript_support_level": 2
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 470,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 1661,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1413,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 11,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000931348.1",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-60+40_-60+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000601407.1",
          "strand": false,
          "transcript": "ENST00000931348.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 434,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 1589,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1305,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 12,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000931347.1",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-60+40_-60+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000601406.1",
          "strand": false,
          "transcript": "ENST00000931347.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 62,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 573,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 189,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 4,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000453600.5",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-327+40_-327+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000408797.1",
          "strand": false,
          "transcript": "ENST00000453600.5",
          "transcript_support_level": 3
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 31,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 562,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 98,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 4,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000451771.5",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-338+40_-338+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000397802.1",
          "strand": false,
          "transcript": "ENST00000451771.5",
          "transcript_support_level": 2
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 645,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_count": 2,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "ENST00000750621.1",
          "gene_hgnc_id": null,
          "gene_symbol": "ENSG00000297732",
          "hgvs_c": "n.123_124insGCGGGGCGCAGGGCGCGGGGCGCAGGGCGCGGGGCGCAGGGC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": true,
          "transcript": "ENST00000750621.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 629,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_count": 2,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "ENST00000750622.1",
          "gene_hgnc_id": null,
          "gene_symbol": "ENSG00000297732",
          "hgvs_c": "n.104_105insGCGGGGCGCAGGGCGCGGGGCGCAGGGCGCGGGGCGCAGGGC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": true,
          "transcript": "ENST00000750622.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 836,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_count": 3,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "ENST00000750623.1",
          "gene_hgnc_id": null,
          "gene_symbol": "ENSG00000297732",
          "hgvs_c": "n.97_98insGCGGGGCGCAGGGCGCGGGGCGCAGGGCGCGGGGCGCAGGGC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": true,
          "transcript": "ENST00000750623.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 436,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_count": 3,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "ENST00000750624.1",
          "gene_hgnc_id": null,
          "gene_symbol": "ENSG00000297732",
          "hgvs_c": "n.130_131insGCGGGGCGCAGGGCGCGGGGCGCAGGGCGCGGGGCGCAGGGC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": true,
          "transcript": "ENST00000750624.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 525,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_count": 3,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "ENST00000750625.1",
          "gene_hgnc_id": null,
          "gene_symbol": "ENSG00000297732",
          "hgvs_c": "n.123_124insGCGGGGCGCAGGGCGCGGGGCGCAGGGCGCGGGGCGCAGGGC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": true,
          "transcript": "ENST00000750625.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 307,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_count": 2,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "ENST00000750626.1",
          "gene_hgnc_id": null,
          "gene_symbol": "ENSG00000297732",
          "hgvs_c": "n.119_120insGCGGGGCGCAGGGCGCGGGGCGCAGGGCGCGGGGCGCAGGGC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": true,
          "transcript": "ENST00000750626.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 500,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_count": 3,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "ENST00000750627.1",
          "gene_hgnc_id": null,
          "gene_symbol": "ENSG00000297732",
          "hgvs_c": "n.114_115insGCGGGGCGCAGGGCGCGGGGCGCAGGGCGCGGGGCGCAGGGC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": true,
          "transcript": "ENST00000750627.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 305,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_count": 2,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "ENST00000750628.1",
          "gene_hgnc_id": null,
          "gene_symbol": "ENSG00000297732",
          "hgvs_c": "n.104_105insGCGGGGCGCAGGGCGCGGGGCGCAGGGCGCGGGGCGCAGGGC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": true,
          "transcript": "ENST00000750628.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 393,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_count": 2,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "ENST00000750629.1",
          "gene_hgnc_id": null,
          "gene_symbol": "ENSG00000297732",
          "hgvs_c": "n.123_124insGCGGGGCGCAGGGCGCGGGGCGCAGGGCGCGGGGCGCAGGGC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": true,
          "transcript": "ENST00000750629.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 2059,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 12,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000641315.1",
          "gene_hgnc_id": null,
          "gene_symbol": "ENSG00000284707",
          "hgvs_c": "n.331-3235_331-3234insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": false,
          "transcript": "ENST00000641315.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 3211,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 18,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000641390.1",
          "gene_hgnc_id": null,
          "gene_symbol": "ENSG00000284707",
          "hgvs_c": "n.895+40_895+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 6,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": false,
          "transcript": "ENST00000641390.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 3743,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 18,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000641784.1",
          "gene_hgnc_id": null,
          "gene_symbol": "ENSG00000284707",
          "hgvs_c": "n.1427+40_1427+41insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 6,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": false,
          "transcript": "ENST00000641784.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 3531,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 19,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "NR_147989.1",
          "gene_hgnc_id": null,
          "gene_symbol": "CZ1P-ASNS",
          "hgvs_c": "n.1571-2498_1571-2497insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": 7,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": false,
          "transcript": "NR_147989.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 561,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 2334,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1686,
          "cds_start": null,
          "consequences": [
            "upstream_gene_variant"
          ],
          "exon_count": 13,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "NM_133436.3",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-652_-651insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "NP_597680.2",
          "strand": true,
          "transcript": "NM_133436.3",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 561,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 2289,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1686,
          "cds_start": null,
          "consequences": [
            "upstream_gene_variant"
          ],
          "exon_count": 13,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000394309.7",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-652_-651insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000377846.3",
          "strand": true,
          "transcript": "ENST00000394309.7",
          "transcript_support_level": 2
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 561,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 2366,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1686,
          "cds_start": null,
          "consequences": [
            "upstream_gene_variant"
          ],
          "exon_count": 14,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000931350.1",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-725_-724insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000601409.1",
          "strand": true,
          "transcript": "ENST00000931350.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 561,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 1931,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1686,
          "cds_start": null,
          "consequences": [
            "upstream_gene_variant"
          ],
          "exon_count": 12,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000968227.1",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-294_-293insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000638286.1",
          "strand": true,
          "transcript": "ENST00000968227.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 478,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 1704,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1437,
          "cds_start": null,
          "consequences": [
            "upstream_gene_variant"
          ],
          "exon_count": 11,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "NM_001178077.1",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-271_-270insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "NP_001171548.1",
          "strand": true,
          "transcript": "NM_001178077.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 478,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 1638,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1437,
          "cds_start": null,
          "consequences": [
            "upstream_gene_variant"
          ],
          "exon_count": 11,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000437628.5",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-271_-270insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000414379.1",
          "strand": true,
          "transcript": "ENST00000437628.5",
          "transcript_support_level": 2
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 213,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 828,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 644,
          "cds_start": null,
          "consequences": [
            "upstream_gene_variant"
          ],
          "exon_count": 5,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000442734.5",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-330_-329insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000400422.1",
          "strand": true,
          "transcript": "ENST00000442734.5",
          "transcript_support_level": 2
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 27,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 584,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 85,
          "cds_start": null,
          "consequences": [
            "upstream_gene_variant"
          ],
          "exon_count": 3,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000414884.1",
          "gene_hgnc_id": 753,
          "gene_symbol": "ASNS",
          "hgvs_c": "c.-652_-651insCTGCGCCCCGCGCCCTGCGCCCCGCGCCCTGCGCCCCGCGCC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000413797.1",
          "strand": true,
          "transcript": "ENST00000414884.1",
          "transcript_support_level": 2
        }
      ],
      "custom_annotations": null,
      "dbscsnv_ada_prediction": null,
      "dbscsnv_ada_score": null,
      "dbsnp": "rs3832526",
      "effect": "intron_variant",
      "frequency_reference_population": null,
      "gene_hgnc_id": 753,
      "gene_symbol": "ASNS",
      "gnomad_exomes_ac": 1,
      "gnomad_exomes_af": 0.00106383,
      "gnomad_exomes_homalt": 0,
      "gnomad_genomes_ac": 208,
      "gnomad_genomes_af": 0.00138197,
      "gnomad_genomes_homalt": 1,
      "gnomad_mito_heteroplasmic": null,
      "gnomad_mito_homoplasmic": null,
      "hom_count_reference_population": null,
      "mitotip_prediction": null,
      "mitotip_score": null,
      "pathogenicity_classification_combined": null,
      "phenotype_combined": null,
      "phylop100way_prediction": "Benign",
      "phylop100way_score": -0.809,
      "pos": 97872310,
      "ref": "T",
      "revel_prediction": null,
      "revel_score": null,
      "splice_prediction_selected": null,
      "splice_score_selected": null,
      "splice_source_selected": null,
      "spliceai_max_prediction": null,
      "spliceai_max_score": null,
      "transcript": "NM_001673.5"
    }
  ]
}
For research and educational, non-commercial use only. Not for clinical or diagnostic use. GeneBe does not provide medical advice. Data use for AI modeling is prohibited: if used, the cost is $0.001 per byte of downloaded uncompressed data.