← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 8-133238956-CCCCTCGCTGGTGTGCGAGCGGCTGCGGGTG-C (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=8&pos=133238956&ref=CCCCTCGCTGGTGTGCGAGCGGCTGCGGGTG&alt=C&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "8",
"pos": 133238956,
"ref": "CCCCTCGCTGGTGTGCGAGCGGCTGCGGGTG",
"alt": "C",
"effect": "disruptive_inframe_deletion",
"transcript": "ENST00000323851.13",
"consequences": [
{
"aa_ref": "GTRSRSHTSEG",
"aa_alt": "G",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NDRG1",
"gene_hgnc_id": 7679,
"hgvs_c": "c.1077_1106delCACCCGCAGCCGCTCGCACACCAGCGAGGG",
"hgvs_p": "p.Thr360_Gly369del",
"transcript": "NM_006096.4",
"protein_id": "NP_006087.2",
"transcript_support_level": null,
"aa_start": 359,
"aa_end": null,
"aa_length": 394,
"cds_start": 1077,
"cds_end": null,
"cds_length": 1185,
"cdna_start": 1243,
"cdna_end": null,
"cdna_length": 3025,
"mane_select": "ENST00000323851.13",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GTRSRSHTSEG",
"aa_alt": "G",
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NDRG1",
"gene_hgnc_id": 7679,
"hgvs_c": "c.1077_1106delCACCCGCAGCCGCTCGCACACCAGCGAGGG",
"hgvs_p": "p.Thr360_Gly369del",
"transcript": "ENST00000323851.13",
"protein_id": "ENSP00000319977.8",
"transcript_support_level": 1,
"aa_start": 359,
"aa_end": null,
"aa_length": 394,
"cds_start": 1077,
"cds_end": null,
"cds_length": 1185,
"cdna_start": 1243,
"cdna_end": null,
"cdna_length": 3025,
"mane_select": "NM_006096.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GTRSRSHTSEG",
"aa_alt": "G",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 14,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NDRG1",
"gene_hgnc_id": 7679,
"hgvs_c": "c.879_908delCACCCGCAGCCGCTCGCACACCAGCGAGGG",
"hgvs_p": "p.Thr294_Gly303del",
"transcript": "ENST00000522476.5",
"protein_id": "ENSP00000427894.1",
"transcript_support_level": 1,
"aa_start": 293,
"aa_end": null,
"aa_length": 328,
"cds_start": 879,
"cds_end": null,
"cds_length": 987,
"cdna_start": 1126,
"cdna_end": null,
"cdna_length": 1385,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GTRSRSHTSEG",
"aa_alt": "G",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NDRG1",
"gene_hgnc_id": 7679,
"hgvs_c": "c.1128_1157delCACCCGCAGCCGCTCGCACACCAGCGAGGG",
"hgvs_p": "p.Thr377_Gly386del",
"transcript": "NM_001374844.1",
"protein_id": "NP_001361773.1",
"transcript_support_level": null,
"aa_start": 376,
"aa_end": null,
"aa_length": 411,
"cds_start": 1128,
"cds_end": null,
"cds_length": 1236,
"cdna_start": 1294,
"cdna_end": null,
"cdna_length": 3076,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GTRSRSHTSEG",
"aa_alt": "G",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NDRG1",
"gene_hgnc_id": 7679,
"hgvs_c": "c.1077_1106delCACCCGCAGCCGCTCGCACACCAGCGAGGG",
"hgvs_p": "p.Thr360_Gly369del",
"transcript": "NM_001135242.2",
"protein_id": "NP_001128714.1",
"transcript_support_level": null,
"aa_start": 359,
"aa_end": null,
"aa_length": 394,
"cds_start": 1077,
"cds_end": null,
"cds_length": 1185,
"cdna_start": 1640,
"cdna_end": null,
"cdna_length": 3422,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GTRSRSHTSEG",
"aa_alt": "G",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NDRG1",
"gene_hgnc_id": 7679,
"hgvs_c": "c.1077_1106delCACCCGCAGCCGCTCGCACACCAGCGAGGG",
"hgvs_p": "p.Thr360_Gly369del",
"transcript": "NM_001374845.1",
"protein_id": "NP_001361774.1",
"transcript_support_level": null,
"aa_start": 359,
"aa_end": null,
"aa_length": 394,
"cds_start": 1077,
"cds_end": null,
"cds_length": 1185,
"cdna_start": 1261,
"cdna_end": null,
"cdna_length": 3043,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GTRSRSHTSEG",
"aa_alt": "G",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NDRG1",
"gene_hgnc_id": 7679,
"hgvs_c": "c.1077_1106delCACCCGCAGCCGCTCGCACACCAGCGAGGG",
"hgvs_p": "p.Thr360_Gly369del",
"transcript": "NM_001374846.1",
"protein_id": "NP_001361775.1",
"transcript_support_level": null,
"aa_start": 359,
"aa_end": null,
"aa_length": 394,
"cds_start": 1077,
"cds_end": null,
"cds_length": 1185,
"cdna_start": 1176,
"cdna_end": null,
"cdna_length": 2958,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GTRSRSHTSEG",
"aa_alt": "G",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NDRG1",
"gene_hgnc_id": 7679,
"hgvs_c": "c.1077_1106delCACCCGCAGCCGCTCGCACACCAGCGAGGG",
"hgvs_p": "p.Thr360_Gly369del",
"transcript": "ENST00000414097.6",
"protein_id": "ENSP00000404854.2",
"transcript_support_level": 2,
"aa_start": 359,
"aa_end": null,
"aa_length": 394,
"cds_start": 1077,
"cds_end": null,
"cds_length": 1185,
"cdna_start": 1974,
"cdna_end": null,
"cdna_length": 3755,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GTRSRSHTSEG",
"aa_alt": "G",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 16,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NDRG1",
"gene_hgnc_id": 7679,
"hgvs_c": "c.1077_1106delCACCCGCAGCCGCTCGCACACCAGCGAGGG",
"hgvs_p": "p.Thr360_Gly369del",
"transcript": "ENST00000537882.3",
"protein_id": "ENSP00000437443.2",
"transcript_support_level": 2,
"aa_start": 359,
"aa_end": null,
"aa_length": 386,
"cds_start": 1077,
"cds_end": null,
"cds_length": 1161,
"cdna_start": 1176,
"cdna_end": null,
"cdna_length": 1231,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GTRSRSHTSEG",
"aa_alt": "G",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 14,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NDRG1",
"gene_hgnc_id": 7679,
"hgvs_c": "c.879_908delCACCCGCAGCCGCTCGCACACCAGCGAGGG",
"hgvs_p": "p.Thr294_Gly303del",
"transcript": "NM_001258432.2",
"protein_id": "NP_001245361.1",
"transcript_support_level": null,
"aa_start": 293,
"aa_end": null,
"aa_length": 328,
"cds_start": 879,
"cds_end": null,
"cds_length": 987,
"cdna_start": 1126,
"cdna_end": null,
"cdna_length": 2908,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GTRSRSHTSEG",
"aa_alt": "G",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 15,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NDRG1",
"gene_hgnc_id": 7679,
"hgvs_c": "c.879_908delCACCCGCAGCCGCTCGCACACCAGCGAGGG",
"hgvs_p": "p.Thr294_Gly303del",
"transcript": "NM_001374847.1",
"protein_id": "NP_001361776.1",
"transcript_support_level": null,
"aa_start": 293,
"aa_end": null,
"aa_length": 328,
"cds_start": 879,
"cds_end": null,
"cds_length": 987,
"cdna_start": 1162,
"cdna_end": null,
"cdna_length": 2944,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GTRSRSHTSEG",
"aa_alt": "G",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 15,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NDRG1",
"gene_hgnc_id": 7679,
"hgvs_c": "c.834_863delCACCCGCAGCCGCTCGCACACCAGCGAGGG",
"hgvs_p": "p.Thr279_Gly288del",
"transcript": "NM_001258433.2",
"protein_id": "NP_001245362.1",
"transcript_support_level": null,
"aa_start": 278,
"aa_end": null,
"aa_length": 313,
"cds_start": 834,
"cds_end": null,
"cds_length": 942,
"cdna_start": 1137,
"cdna_end": null,
"cdna_length": 2919,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GTRSRSHTSEG",
"aa_alt": "G",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NDRG1",
"gene_hgnc_id": 7679,
"hgvs_c": "c.318_347delCACCCGCAGCCGCTCGCACACCAGCGAGGG",
"hgvs_p": "p.Thr107_Gly116del",
"transcript": "ENST00000518176.5",
"protein_id": "ENSP00000429007.1",
"transcript_support_level": 2,
"aa_start": 106,
"aa_end": null,
"aa_length": 141,
"cds_start": 318,
"cds_end": null,
"cds_length": 426,
"cdna_start": 469,
"cdna_end": null,
"cdna_length": 888,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "GTRSRSHTSEG",
"aa_alt": "G",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NDRG1",
"gene_hgnc_id": 7679,
"hgvs_c": "c.204_233delCACCCGCAGCCGCTCGCACACCAGCGAGGG",
"hgvs_p": "p.Thr69_Gly78del",
"transcript": "ENST00000518066.5",
"protein_id": "ENSP00000431057.1",
"transcript_support_level": 5,
"aa_start": 68,
"aa_end": null,
"aa_length": 103,
"cds_start": 204,
"cds_end": null,
"cds_length": 312,
"cdna_start": 370,
"cdna_end": null,
"cdna_length": 560,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 15,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NDRG1",
"gene_hgnc_id": 7679,
"hgvs_c": "n.*683_*712delCACCCGCAGCCGCTCGCACACCAGCGAGGG",
"hgvs_p": null,
"transcript": "ENST00000517599.5",
"protein_id": "ENSP00000429172.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2918,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NDRG1",
"gene_hgnc_id": 7679,
"hgvs_c": "n.2173_2202delCACCCGCAGCCGCTCGCACACCAGCGAGGG",
"hgvs_p": null,
"transcript": "ENST00000519278.5",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3983,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NDRG1",
"gene_hgnc_id": 7679,
"hgvs_c": "n.335_364delCACCCGCAGCCGCTCGCACACCAGCGAGGG",
"hgvs_p": null,
"transcript": "ENST00000521026.5",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2145,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NDRG1",
"gene_hgnc_id": 7679,
"hgvs_c": "n.539_568delCACCCGCAGCCGCTCGCACACCAGCGAGGG",
"hgvs_p": null,
"transcript": "ENST00000521414.5",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2349,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 15,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "NDRG1",
"gene_hgnc_id": 7679,
"hgvs_c": "n.*683_*712delCACCCGCAGCCGCTCGCACACCAGCGAGGG",
"hgvs_p": null,
"transcript": "ENST00000517599.5",
"protein_id": "ENSP00000429172.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2918,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "NDRG1",
"gene_hgnc_id": 7679,
"hgvs_c": "n.2456+86_2456+115delCACCCGCAGCCGCTCGCACACCAGCGAGGG",
"hgvs_p": null,
"transcript": "ENST00000521438.1",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2810,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "NDRG1",
"gene_hgnc_id": 7679,
"dbsnp": "rs1554747463",
"frequency_reference_population": 0.000008236543,
"hom_count_reference_population": 0,
"allele_count_reference_population": 13,
"gnomad_exomes_af": 0.00000701029,
"gnomad_genomes_af": 0.0000197553,
"gnomad_exomes_ac": 10,
"gnomad_genomes_ac": 3,
"gnomad_exomes_homalt": 0,
"gnomad_genomes_homalt": 0,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 7.583,
"phylop100way_prediction": "Pathogenic",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 3,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "PM4,PP3",
"acmg_by_gene": [
{
"score": 3,
"benign_score": 0,
"pathogenic_score": 3,
"criteria": [
"PM4",
"PP3"
],
"verdict": "Uncertain_significance",
"transcript": "ENST00000323851.13",
"gene_symbol": "NDRG1",
"hgnc_id": 7679,
"effects": [
"disruptive_inframe_deletion"
],
"inheritance_mode": "AR",
"hgvs_c": "c.1077_1106delCACCCGCAGCCGCTCGCACACCAGCGAGGG",
"hgvs_p": "p.Thr360_Gly369del"
}
],
"clinvar_disease": "Charcot-Marie-Tooth disease type 4",
"clinvar_classification": "Uncertain significance",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "US:1",
"phenotype_combined": "Charcot-Marie-Tooth disease type 4",
"pathogenicity_classification_combined": "Uncertain significance",
"custom_annotations": null
}
],
"message": null
}