← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 8-133238971-CGAGCGGCTGCGGGTGCCCTCGCTGGTGTGGGAGCGGCTTCGGGTGCCCTCGCTGGTGTGG-C (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=8&pos=133238971&ref=CGAGCGGCTGCGGGTGCCCTCGCTGGTGTGGGAGCGGCTTCGGGTGCCCTCGCTGGTGTGG&alt=C&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "8",
      "pos": 133238971,
      "ref": "CGAGCGGCTGCGGGTGCCCTCGCTGGTGTGGGAGCGGCTTCGGGTGCCCTCGCTGGTGTGG",
      "alt": "C",
      "effect": "disruptive_inframe_deletion",
      "transcript": "ENST00000323851.13",
      "consequences": [
        {
          "aa_ref": "SHTSEGTRSRSHTSEGTRSRS",
          "aa_alt": "S",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDRG1",
          "gene_hgnc_id": 7679,
          "hgvs_c": "c.1032_1091delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC",
          "hgvs_p": "p.His345_Ser364del",
          "transcript": "NM_006096.4",
          "protein_id": "NP_006087.2",
          "transcript_support_level": null,
          "aa_start": 344,
          "aa_end": null,
          "aa_length": 394,
          "cds_start": 1032,
          "cds_end": null,
          "cds_length": 1185,
          "cdna_start": 1228,
          "cdna_end": null,
          "cdna_length": 3025,
          "mane_select": "ENST00000323851.13",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "SHTSEGTRSRSHTSEGTRSRS",
          "aa_alt": "S",
          "canonical": true,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDRG1",
          "gene_hgnc_id": 7679,
          "hgvs_c": "c.1032_1091delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC",
          "hgvs_p": "p.His345_Ser364del",
          "transcript": "ENST00000323851.13",
          "protein_id": "ENSP00000319977.8",
          "transcript_support_level": 1,
          "aa_start": 344,
          "aa_end": null,
          "aa_length": 394,
          "cds_start": 1032,
          "cds_end": null,
          "cds_length": 1185,
          "cdna_start": 1228,
          "cdna_end": null,
          "cdna_length": 3025,
          "mane_select": "NM_006096.4",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "SHTSEGTRSRSHTSEGTRSRS",
          "aa_alt": "S",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 14,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDRG1",
          "gene_hgnc_id": 7679,
          "hgvs_c": "c.834_893delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC",
          "hgvs_p": "p.His279_Ser298del",
          "transcript": "ENST00000522476.5",
          "protein_id": "ENSP00000427894.1",
          "transcript_support_level": 1,
          "aa_start": 278,
          "aa_end": null,
          "aa_length": 328,
          "cds_start": 834,
          "cds_end": null,
          "cds_length": 987,
          "cdna_start": 1111,
          "cdna_end": null,
          "cdna_length": 1385,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "SHTSEGTRSRSHTSEGTRSRS",
          "aa_alt": "S",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDRG1",
          "gene_hgnc_id": 7679,
          "hgvs_c": "c.1083_1142delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC",
          "hgvs_p": "p.His362_Ser381del",
          "transcript": "NM_001374844.1",
          "protein_id": "NP_001361773.1",
          "transcript_support_level": null,
          "aa_start": 361,
          "aa_end": null,
          "aa_length": 411,
          "cds_start": 1083,
          "cds_end": null,
          "cds_length": 1236,
          "cdna_start": 1279,
          "cdna_end": null,
          "cdna_length": 3076,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "SHTSEGTRSRSHTSEGTRSRS",
          "aa_alt": "S",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDRG1",
          "gene_hgnc_id": 7679,
          "hgvs_c": "c.1032_1091delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC",
          "hgvs_p": "p.His345_Ser364del",
          "transcript": "NM_001135242.2",
          "protein_id": "NP_001128714.1",
          "transcript_support_level": null,
          "aa_start": 344,
          "aa_end": null,
          "aa_length": 394,
          "cds_start": 1032,
          "cds_end": null,
          "cds_length": 1185,
          "cdna_start": 1625,
          "cdna_end": null,
          "cdna_length": 3422,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "SHTSEGTRSRSHTSEGTRSRS",
          "aa_alt": "S",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDRG1",
          "gene_hgnc_id": 7679,
          "hgvs_c": "c.1032_1091delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC",
          "hgvs_p": "p.His345_Ser364del",
          "transcript": "NM_001374845.1",
          "protein_id": "NP_001361774.1",
          "transcript_support_level": null,
          "aa_start": 344,
          "aa_end": null,
          "aa_length": 394,
          "cds_start": 1032,
          "cds_end": null,
          "cds_length": 1185,
          "cdna_start": 1246,
          "cdna_end": null,
          "cdna_length": 3043,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "SHTSEGTRSRSHTSEGTRSRS",
          "aa_alt": "S",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDRG1",
          "gene_hgnc_id": 7679,
          "hgvs_c": "c.1032_1091delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC",
          "hgvs_p": "p.His345_Ser364del",
          "transcript": "NM_001374846.1",
          "protein_id": "NP_001361775.1",
          "transcript_support_level": null,
          "aa_start": 344,
          "aa_end": null,
          "aa_length": 394,
          "cds_start": 1032,
          "cds_end": null,
          "cds_length": 1185,
          "cdna_start": 1161,
          "cdna_end": null,
          "cdna_length": 2958,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "SHTSEGTRSRSHTSEGTRSRS",
          "aa_alt": "S",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDRG1",
          "gene_hgnc_id": 7679,
          "hgvs_c": "c.1032_1091delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC",
          "hgvs_p": "p.His345_Ser364del",
          "transcript": "ENST00000414097.6",
          "protein_id": "ENSP00000404854.2",
          "transcript_support_level": 2,
          "aa_start": 344,
          "aa_end": null,
          "aa_length": 394,
          "cds_start": 1032,
          "cds_end": null,
          "cds_length": 1185,
          "cdna_start": 1959,
          "cdna_end": null,
          "cdna_length": 3755,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "SHTSEGTRSRSHTSEGTRSRS",
          "aa_alt": "S",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 16,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDRG1",
          "gene_hgnc_id": 7679,
          "hgvs_c": "c.1032_1091delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC",
          "hgvs_p": "p.His345_Ser364del",
          "transcript": "ENST00000537882.3",
          "protein_id": "ENSP00000437443.2",
          "transcript_support_level": 2,
          "aa_start": 344,
          "aa_end": null,
          "aa_length": 386,
          "cds_start": 1032,
          "cds_end": null,
          "cds_length": 1161,
          "cdna_start": 1161,
          "cdna_end": null,
          "cdna_length": 1231,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "SHTSEGTRSRSHTSEGTRSRS",
          "aa_alt": "S",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 14,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDRG1",
          "gene_hgnc_id": 7679,
          "hgvs_c": "c.834_893delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC",
          "hgvs_p": "p.His279_Ser298del",
          "transcript": "NM_001258432.2",
          "protein_id": "NP_001245361.1",
          "transcript_support_level": null,
          "aa_start": 278,
          "aa_end": null,
          "aa_length": 328,
          "cds_start": 834,
          "cds_end": null,
          "cds_length": 987,
          "cdna_start": 1111,
          "cdna_end": null,
          "cdna_length": 2908,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "SHTSEGTRSRSHTSEGTRSRS",
          "aa_alt": "S",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 15,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDRG1",
          "gene_hgnc_id": 7679,
          "hgvs_c": "c.834_893delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC",
          "hgvs_p": "p.His279_Ser298del",
          "transcript": "NM_001374847.1",
          "protein_id": "NP_001361776.1",
          "transcript_support_level": null,
          "aa_start": 278,
          "aa_end": null,
          "aa_length": 328,
          "cds_start": 834,
          "cds_end": null,
          "cds_length": 987,
          "cdna_start": 1147,
          "cdna_end": null,
          "cdna_length": 2944,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "SHTSEGTRSRSHTSEGTRSRS",
          "aa_alt": "S",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 15,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDRG1",
          "gene_hgnc_id": 7679,
          "hgvs_c": "c.789_848delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC",
          "hgvs_p": "p.His264_Ser283del",
          "transcript": "NM_001258433.2",
          "protein_id": "NP_001245362.1",
          "transcript_support_level": null,
          "aa_start": 263,
          "aa_end": null,
          "aa_length": 313,
          "cds_start": 789,
          "cds_end": null,
          "cds_length": 942,
          "cdna_start": 1122,
          "cdna_end": null,
          "cdna_length": 2919,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "SHTSEGTRSRSHTSEGTRSRS",
          "aa_alt": "S",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDRG1",
          "gene_hgnc_id": 7679,
          "hgvs_c": "c.273_332delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC",
          "hgvs_p": "p.His92_Ser111del",
          "transcript": "ENST00000518176.5",
          "protein_id": "ENSP00000429007.1",
          "transcript_support_level": 2,
          "aa_start": 91,
          "aa_end": null,
          "aa_length": 141,
          "cds_start": 273,
          "cds_end": null,
          "cds_length": 426,
          "cdna_start": 454,
          "cdna_end": null,
          "cdna_length": 888,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "SHTSEGTRSRSHTSEGTRSRS",
          "aa_alt": "S",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDRG1",
          "gene_hgnc_id": 7679,
          "hgvs_c": "c.159_218delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC",
          "hgvs_p": "p.His54_Ser73del",
          "transcript": "ENST00000518066.5",
          "protein_id": "ENSP00000431057.1",
          "transcript_support_level": 5,
          "aa_start": 53,
          "aa_end": null,
          "aa_length": 103,
          "cds_start": 159,
          "cds_end": null,
          "cds_length": 312,
          "cdna_start": 355,
          "cdna_end": null,
          "cdna_length": 560,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 15,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDRG1",
          "gene_hgnc_id": 7679,
          "hgvs_c": "n.*638_*697delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC",
          "hgvs_p": null,
          "transcript": "ENST00000517599.5",
          "protein_id": "ENSP00000429172.1",
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2918,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDRG1",
          "gene_hgnc_id": 7679,
          "hgvs_c": "n.2128_2187delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC",
          "hgvs_p": null,
          "transcript": "ENST00000519278.5",
          "protein_id": null,
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3983,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 3,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDRG1",
          "gene_hgnc_id": 7679,
          "hgvs_c": "n.290_349delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC",
          "hgvs_p": null,
          "transcript": "ENST00000521026.5",
          "protein_id": null,
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2145,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDRG1",
          "gene_hgnc_id": 7679,
          "hgvs_c": "n.494_553delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC",
          "hgvs_p": null,
          "transcript": "ENST00000521414.5",
          "protein_id": null,
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2349,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 15,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDRG1",
          "gene_hgnc_id": 7679,
          "hgvs_c": "n.*638_*697delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC",
          "hgvs_p": null,
          "transcript": "ENST00000517599.5",
          "protein_id": "ENSP00000429172.1",
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2918,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 2,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "NDRG1",
          "gene_hgnc_id": 7679,
          "hgvs_c": "n.2456+41_2456+100delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC",
          "hgvs_p": null,
          "transcript": "ENST00000521438.1",
          "protein_id": null,
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2810,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "NDRG1",
      "gene_hgnc_id": 7679,
      "dbsnp": "rs1554747479",
      "frequency_reference_population": 6.965864e-7,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 1,
      "gnomad_exomes_af": 6.96586e-7,
      "gnomad_genomes_af": null,
      "gnomad_exomes_ac": 1,
      "gnomad_genomes_ac": null,
      "gnomad_exomes_homalt": 0,
      "gnomad_genomes_homalt": null,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 6.181,
      "phylop100way_prediction": "Uncertain_significance",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 2,
      "acmg_classification": "Uncertain_significance",
      "acmg_criteria": "PM4",
      "acmg_by_gene": [
        {
          "score": 2,
          "benign_score": 0,
          "pathogenic_score": 2,
          "criteria": [
            "PM4"
          ],
          "verdict": "Uncertain_significance",
          "transcript": "ENST00000323851.13",
          "gene_symbol": "NDRG1",
          "hgnc_id": 7679,
          "effects": [
            "disruptive_inframe_deletion"
          ],
          "inheritance_mode": "AR",
          "hgvs_c": "c.1032_1091delCCACACCAGCGAGGGCACCCGAAGCCGCTCCCACACCAGCGAGGGCACCCGCAGCCGCTC",
          "hgvs_p": "p.His345_Ser364del"
        }
      ],
      "clinvar_disease": "Charcot-Marie-Tooth disease type 4",
      "clinvar_classification": "Uncertain significance",
      "clinvar_review_status": "criteria provided, single submitter",
      "clinvar_submissions_summary": "US:1",
      "phenotype_combined": "Charcot-Marie-Tooth disease type 4",
      "pathogenicity_classification_combined": "Uncertain significance",
      "custom_annotations": null
    }
  ],
  "message": null
}