← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 9-136433147-G-GCGCCCACCCCTCCAGCCGCGCCCACCCCTCCAGCCA (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=9&pos=136433147&ref=G&alt=GCGCCCACCCCTCCAGCCGCGCCCACCCCTCCAGCCA&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "9",
      "pos": 136433147,
      "ref": "G",
      "alt": "GCGCCCACCCCTCCAGCCGCGCCCACCCCTCCAGCCA",
      "effect": "splice_region_variant,intron_variant",
      "transcript": "ENST00000371712.4",
      "consequences": [
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": 4,
          "intron_rank_end": null,
          "gene_symbol": "INPP5E",
          "gene_hgnc_id": 21474,
          "hgvs_c": "c.1159+7_1159+8insTGGCTGGAGGGGTGGGCGCGGCTGGAGGGGTGGGCG",
          "hgvs_p": null,
          "transcript": "NM_019892.6",
          "protein_id": "NP_063945.2",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 644,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 1935,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3417,
          "mane_select": "ENST00000371712.4",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": 4,
          "intron_rank_end": null,
          "gene_symbol": "INPP5E",
          "gene_hgnc_id": 21474,
          "hgvs_c": "c.1159+7_1159+8insTGGCTGGAGGGGTGGGCGCGGCTGGAGGGGTGGGCG",
          "hgvs_p": null,
          "transcript": "ENST00000371712.4",
          "protein_id": "ENSP00000360777.3",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 644,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 1935,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3417,
          "mane_select": "NM_019892.6",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": 4,
          "intron_rank_end": null,
          "gene_symbol": "INPP5E",
          "gene_hgnc_id": 21474,
          "hgvs_c": "c.1159+7_1159+8insTGGCTGGAGGGGTGGGCGCGGCTGGAGGGGTGGGCG",
          "hgvs_p": null,
          "transcript": "NM_001318502.2",
          "protein_id": "NP_001305431.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 643,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 1932,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3414,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": 4,
          "intron_rank_end": null,
          "gene_symbol": "INPP5E",
          "gene_hgnc_id": 21474,
          "hgvs_c": "c.1057+7_1057+8insTGGCTGGAGGGGTGGGCGCGGCTGGAGGGGTGGGCG",
          "hgvs_p": null,
          "transcript": "ENST00000676019.1",
          "protein_id": "ENSP00000501984.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 610,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 1833,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3315,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": 4,
          "intron_rank_end": null,
          "gene_symbol": "INPP5E",
          "gene_hgnc_id": 21474,
          "hgvs_c": "c.1159+7_1159+8insTGGCTGGAGGGGTGGGCGCGGCTGGAGGGGTGGGCG",
          "hgvs_p": null,
          "transcript": "XM_017014926.2",
          "protein_id": "XP_016870415.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 602,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 1809,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3370,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": 4,
          "intron_rank_end": null,
          "gene_symbol": "INPP5E",
          "gene_hgnc_id": 21474,
          "hgvs_c": "c.1159+7_1159+8insTGGCTGGAGGGGTGGGCGCGGCTGGAGGGGTGGGCG",
          "hgvs_p": null,
          "transcript": "XM_047423603.1",
          "protein_id": "XP_047279559.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 601,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 1806,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3367,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "splice_region_variant",
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 4,
          "intron_rank_end": null,
          "gene_symbol": "INPP5E",
          "gene_hgnc_id": 21474,
          "hgvs_c": "n.1585+7_1585+8insTGGCTGGAGGGGTGGGCGCGGCTGGAGGGGTGGGCG",
          "hgvs_p": null,
          "transcript": "XR_929828.3",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2066,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "INPP5E",
      "gene_hgnc_id": 21474,
      "dbsnp": "rs71269007",
      "frequency_reference_population": null,
      "hom_count_reference_population": null,
      "allele_count_reference_population": null,
      "gnomad_exomes_af": 0.00014805,
      "gnomad_genomes_af": 0.000155039,
      "gnomad_exomes_ac": 215,
      "gnomad_genomes_ac": 23,
      "gnomad_exomes_homalt": 0,
      "gnomad_genomes_homalt": 0,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": -0.695,
      "phylop100way_prediction": "Benign",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": -2,
      "acmg_classification": "Likely_benign",
      "acmg_criteria": "BP6_Moderate",
      "acmg_by_gene": [
        {
          "score": -2,
          "benign_score": 2,
          "pathogenic_score": 0,
          "criteria": [
            "BP6_Moderate"
          ],
          "verdict": "Likely_benign",
          "transcript": "ENST00000371712.4",
          "gene_symbol": "INPP5E",
          "hgnc_id": 21474,
          "effects": [
            "splice_region_variant",
            "intron_variant"
          ],
          "inheritance_mode": "AR",
          "hgvs_c": "c.1159+7_1159+8insTGGCTGGAGGGGTGGGCGCGGCTGGAGGGGTGGGCG",
          "hgvs_p": null
        }
      ],
      "clinvar_disease": "Joubert syndrome",
      "clinvar_classification": "Benign",
      "clinvar_review_status": "criteria provided, single submitter",
      "clinvar_submissions_summary": "B:1",
      "phenotype_combined": "Joubert syndrome",
      "pathogenicity_classification_combined": "Benign",
      "custom_annotations": null
    }
  ],
  "message": null
}