← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: X-108601902-G-GGGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCT (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=X&pos=108601902&ref=G&alt=GGGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCT&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "X",
"pos": 108601902,
"ref": "G",
"alt": "GGGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCT",
"effect": "frameshift_variant",
"transcript": "ENST00000328300.11",
"consequences": [
{
"aa_ref": "G",
"aa_alt": "GNQACQGYLVAKENQVSL?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 27,
"exon_rank_end": null,
"exon_count": 53,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "COL4A5",
"gene_hgnc_id": 2207,
"hgvs_c": "c.2062_2114dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG",
"hgvs_p": "p.Ile706fs",
"transcript": "NM_033380.3",
"protein_id": "NP_203699.1",
"transcript_support_level": null,
"aa_start": 705,
"aa_end": null,
"aa_length": 1691,
"cds_start": 2115,
"cds_end": null,
"cds_length": 5076,
"cdna_start": 2403,
"cdna_end": null,
"cdna_length": 6531,
"mane_select": "ENST00000328300.11",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "G",
"aa_alt": "GNQACQGYLVAKENQVSL?",
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 27,
"exon_rank_end": null,
"exon_count": 53,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "COL4A5",
"gene_hgnc_id": 2207,
"hgvs_c": "c.2062_2114dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG",
"hgvs_p": "p.Ile706fs",
"transcript": "ENST00000328300.11",
"protein_id": "ENSP00000331902.7",
"transcript_support_level": 1,
"aa_start": 705,
"aa_end": null,
"aa_length": 1691,
"cds_start": 2115,
"cds_end": null,
"cds_length": 5076,
"cdna_start": 2403,
"cdna_end": null,
"cdna_length": 6531,
"mane_select": "NM_033380.3",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "G",
"aa_alt": "GNQACQGYLVAKENQVSL?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "COL4A5",
"gene_hgnc_id": 2207,
"hgvs_c": "c.886_938dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG",
"hgvs_p": "p.Ile314fs",
"transcript": "ENST00000483338.1",
"protein_id": "ENSP00000495685.1",
"transcript_support_level": 1,
"aa_start": 313,
"aa_end": null,
"aa_length": 695,
"cds_start": 939,
"cds_end": null,
"cds_length": 2088,
"cdna_start": 1571,
"cdna_end": null,
"cdna_length": 3622,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "G",
"aa_alt": "GNQACQGYLVAKENQVSL?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 27,
"exon_rank_end": null,
"exon_count": 51,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "COL4A5",
"gene_hgnc_id": 2207,
"hgvs_c": "c.2062_2114dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG",
"hgvs_p": "p.Ile706fs",
"transcript": "NM_000495.5",
"protein_id": "NP_000486.1",
"transcript_support_level": null,
"aa_start": 705,
"aa_end": null,
"aa_length": 1685,
"cds_start": 2115,
"cds_end": null,
"cds_length": 5058,
"cdna_start": 2403,
"cdna_end": null,
"cdna_length": 6513,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "G",
"aa_alt": "GNQACQGYLVAKENQVSL?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 27,
"exon_rank_end": null,
"exon_count": 51,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "COL4A5",
"gene_hgnc_id": 2207,
"hgvs_c": "c.2062_2114dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG",
"hgvs_p": "p.Ile706fs",
"transcript": "ENST00000361603.7",
"protein_id": "ENSP00000354505.2",
"transcript_support_level": 2,
"aa_start": 705,
"aa_end": null,
"aa_length": 1685,
"cds_start": 2115,
"cds_end": null,
"cds_length": 5058,
"cdna_start": 2317,
"cdna_end": null,
"cdna_length": 6427,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "G",
"aa_alt": "GNQACQGYLVAKENQVSL?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 28,
"exon_rank_end": null,
"exon_count": 54,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "COL4A5",
"gene_hgnc_id": 2207,
"hgvs_c": "c.2077_2129dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG",
"hgvs_p": "p.Ile711fs",
"transcript": "XM_011530849.3",
"protein_id": "XP_011529151.2",
"transcript_support_level": null,
"aa_start": 710,
"aa_end": null,
"aa_length": 1696,
"cds_start": 2130,
"cds_end": null,
"cds_length": 5091,
"cdna_start": 2145,
"cdna_end": null,
"cdna_length": 6273,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "G",
"aa_alt": "GNQACQGYLVAKENQVSL?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 28,
"exon_rank_end": null,
"exon_count": 53,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "COL4A5",
"gene_hgnc_id": 2207,
"hgvs_c": "c.2077_2129dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG",
"hgvs_p": "p.Ile711fs",
"transcript": "XM_017029259.3",
"protein_id": "XP_016884748.1",
"transcript_support_level": null,
"aa_start": 710,
"aa_end": null,
"aa_length": 1693,
"cds_start": 2130,
"cds_end": null,
"cds_length": 5082,
"cdna_start": 2145,
"cdna_end": null,
"cdna_length": 6264,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "G",
"aa_alt": "GNQACQGYLVAKENQVSL?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 28,
"exon_rank_end": null,
"exon_count": 52,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "COL4A5",
"gene_hgnc_id": 2207,
"hgvs_c": "c.2077_2129dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG",
"hgvs_p": "p.Ile711fs",
"transcript": "XM_017029260.2",
"protein_id": "XP_016884749.1",
"transcript_support_level": null,
"aa_start": 710,
"aa_end": null,
"aa_length": 1690,
"cds_start": 2130,
"cds_end": null,
"cds_length": 5073,
"cdna_start": 2145,
"cdna_end": null,
"cdna_length": 6255,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "G",
"aa_alt": "GNQACQGYLVAKENQVSL?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 28,
"exon_rank_end": null,
"exon_count": 54,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "COL4A5",
"gene_hgnc_id": 2207,
"hgvs_c": "c.1738_1790dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG",
"hgvs_p": "p.Ile598fs",
"transcript": "XM_047441810.1",
"protein_id": "XP_047297766.1",
"transcript_support_level": null,
"aa_start": 597,
"aa_end": null,
"aa_length": 1583,
"cds_start": 1791,
"cds_end": null,
"cds_length": 4752,
"cdna_start": 2455,
"cdna_end": null,
"cdna_length": 6583,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "G",
"aa_alt": "GNQACQGYLVAKENQVSL?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 28,
"exon_rank_end": null,
"exon_count": 46,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "COL4A5",
"gene_hgnc_id": 2207,
"hgvs_c": "c.2077_2129dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG",
"hgvs_p": "p.Ile711fs",
"transcript": "XM_017029261.2",
"protein_id": "XP_016884750.1",
"transcript_support_level": null,
"aa_start": 710,
"aa_end": null,
"aa_length": 1330,
"cds_start": 2130,
"cds_end": null,
"cds_length": 3993,
"cdna_start": 2145,
"cdna_end": null,
"cdna_length": 4398,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "G",
"aa_alt": "GNQACQGYLVAKENQVSL?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 28,
"exon_rank_end": null,
"exon_count": 43,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "COL4A5",
"gene_hgnc_id": 2207,
"hgvs_c": "c.2077_2129dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG",
"hgvs_p": "p.Ile711fs",
"transcript": "XM_017029262.3",
"protein_id": "XP_016884751.1",
"transcript_support_level": null,
"aa_start": 710,
"aa_end": null,
"aa_length": 1289,
"cds_start": 2130,
"cds_end": null,
"cds_length": 3870,
"cdna_start": 2145,
"cdna_end": null,
"cdna_length": 4407,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "G",
"aa_alt": "GNQACQGYLVAKENQVSL?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 27,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "COL4A5",
"gene_hgnc_id": 2207,
"hgvs_c": "c.2062_2114dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG",
"hgvs_p": "p.Ile706fs",
"transcript": "XM_047441811.1",
"protein_id": "XP_047297767.1",
"transcript_support_level": null,
"aa_start": 705,
"aa_end": null,
"aa_length": 1284,
"cds_start": 2115,
"cds_end": null,
"cds_length": 3855,
"cdna_start": 2403,
"cdna_end": null,
"cdna_length": 4665,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "COL4A5",
"gene_hgnc_id": 2207,
"dbsnp": "rs104886342",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 9.257,
"phylop100way_prediction": "Pathogenic",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 8,
"acmg_classification": "Likely_pathogenic",
"acmg_criteria": "PVS1",
"acmg_by_gene": [
{
"score": 8,
"benign_score": 0,
"pathogenic_score": 8,
"criteria": [
"PVS1"
],
"verdict": "Likely_pathogenic",
"transcript": "ENST00000328300.11",
"gene_symbol": "COL4A5",
"hgnc_id": 2207,
"effects": [
"frameshift_variant"
],
"inheritance_mode": "XL",
"hgvs_c": "c.2062_2114dupCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGG",
"hgvs_p": "p.Ile706fs"
}
],
"clinvar_disease": "",
"clinvar_classification": "",
"clinvar_review_status": "",
"clinvar_submissions_summary": "",
"phenotype_combined": null,
"pathogenicity_classification_combined": null,
"custom_annotations": null
}
],
"message": null
}