← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: X-154030633-GGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTGGGAGCA-G (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=X&pos=154030633&ref=GGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTGGGAGCA&alt=G&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "X",
"pos": 154030633,
"ref": "GGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTGGGAGCA",
"alt": "G",
"effect": "frameshift_variant",
"transcript": "ENST00000453960.7",
"consequences": [
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.1181_1230delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu394fs",
"transcript": "NM_001110792.2",
"protein_id": "NP_001104262.1",
"transcript_support_level": null,
"aa_start": 394,
"aa_end": null,
"aa_length": 498,
"cds_start": 1181,
"cds_end": null,
"cds_length": 1497,
"cdna_start": 1282,
"cdna_end": null,
"cdna_length": 10343,
"mane_select": "ENST00000453960.7",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.1181_1230delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu394fs",
"transcript": "ENST00000453960.7",
"protein_id": "ENSP00000395535.2",
"transcript_support_level": 1,
"aa_start": 394,
"aa_end": null,
"aa_length": 498,
"cds_start": 1181,
"cds_end": null,
"cds_length": 1497,
"cdna_start": 1282,
"cdna_end": null,
"cdna_length": 10343,
"mane_select": "NM_001110792.2",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.1145_1194delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu382fs",
"transcript": "NM_004992.4",
"protein_id": "NP_004983.1",
"transcript_support_level": null,
"aa_start": 382,
"aa_end": null,
"aa_length": 486,
"cds_start": 1145,
"cds_end": null,
"cds_length": 1461,
"cdna_start": 1406,
"cdna_end": null,
"cdna_length": 10467,
"mane_select": null,
"mane_plus": "ENST00000303391.11",
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.1145_1194delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu382fs",
"transcript": "ENST00000303391.11",
"protein_id": "ENSP00000301948.6",
"transcript_support_level": 1,
"aa_start": 382,
"aa_end": null,
"aa_length": 486,
"cds_start": 1145,
"cds_end": null,
"cds_length": 1461,
"cdna_start": 1406,
"cdna_end": null,
"cdna_length": 10467,
"mane_select": null,
"mane_plus": "NM_004992.4",
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.1145_1194delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu382fs",
"transcript": "ENST00000630151.3",
"protein_id": "ENSP00000486089.2",
"transcript_support_level": 5,
"aa_start": 382,
"aa_end": null,
"aa_length": 486,
"cds_start": 1145,
"cds_end": null,
"cds_length": 1461,
"cdna_start": 1391,
"cdna_end": null,
"cdna_length": 10452,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.866_915delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu289fs",
"transcript": "NM_001316337.2",
"protein_id": "NP_001303266.1",
"transcript_support_level": null,
"aa_start": 289,
"aa_end": null,
"aa_length": 393,
"cds_start": 866,
"cds_end": null,
"cds_length": 1182,
"cdna_start": 1574,
"cdna_end": null,
"cdna_length": 10635,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.866_915delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu289fs",
"transcript": "NM_001369391.2",
"protein_id": "NP_001356320.1",
"transcript_support_level": null,
"aa_start": 289,
"aa_end": null,
"aa_length": 393,
"cds_start": 866,
"cds_end": null,
"cds_length": 1182,
"cdna_start": 1869,
"cdna_end": null,
"cdna_length": 10930,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.866_915delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu289fs",
"transcript": "NM_001369392.2",
"protein_id": "NP_001356321.1",
"transcript_support_level": null,
"aa_start": 289,
"aa_end": null,
"aa_length": 393,
"cds_start": 866,
"cds_end": null,
"cds_length": 1182,
"cdna_start": 1518,
"cdna_end": null,
"cdna_length": 10579,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.866_915delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu289fs",
"transcript": "NM_001369393.2",
"protein_id": "NP_001356322.1",
"transcript_support_level": null,
"aa_start": 289,
"aa_end": null,
"aa_length": 393,
"cds_start": 866,
"cds_end": null,
"cds_length": 1182,
"cdna_start": 1394,
"cdna_end": null,
"cdna_length": 10455,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.866_915delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu289fs",
"transcript": "NM_001369394.2",
"protein_id": "NP_001356323.1",
"transcript_support_level": null,
"aa_start": 289,
"aa_end": null,
"aa_length": 393,
"cds_start": 866,
"cds_end": null,
"cds_length": 1182,
"cdna_start": 1325,
"cdna_end": null,
"cdna_length": 10386,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.686_735delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu229fs",
"transcript": "ENST00000637917.2",
"protein_id": "ENSP00000489847.2",
"transcript_support_level": 5,
"aa_start": 229,
"aa_end": null,
"aa_length": 333,
"cds_start": 686,
"cds_end": null,
"cds_length": 1002,
"cdna_start": 967,
"cdna_end": null,
"cdna_length": 1298,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.476_525delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu159fs",
"transcript": "NM_001386137.1",
"protein_id": "NP_001373066.1",
"transcript_support_level": null,
"aa_start": 159,
"aa_end": null,
"aa_length": 263,
"cds_start": 476,
"cds_end": null,
"cds_length": 792,
"cdna_start": 1409,
"cdna_end": null,
"cdna_length": 10470,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.476_525delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu159fs",
"transcript": "NM_001386138.1",
"protein_id": "NP_001373067.1",
"transcript_support_level": null,
"aa_start": 159,
"aa_end": null,
"aa_length": 263,
"cds_start": 476,
"cds_end": null,
"cds_length": 792,
"cdna_start": 1297,
"cdna_end": null,
"cdna_length": 10358,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.476_525delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu159fs",
"transcript": "NM_001386139.1",
"protein_id": "NP_001373068.1",
"transcript_support_level": null,
"aa_start": 159,
"aa_end": null,
"aa_length": 263,
"cds_start": 476,
"cds_end": null,
"cds_length": 792,
"cdna_start": 1173,
"cdna_end": null,
"cdna_length": 10234,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.1145_1194delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu382fs",
"transcript": "XM_047442115.1",
"protein_id": "XP_047298071.1",
"transcript_support_level": null,
"aa_start": 382,
"aa_end": null,
"aa_length": 486,
"cds_start": 1145,
"cds_end": null,
"cds_length": 1461,
"cdna_start": 2534,
"cdna_end": null,
"cdna_length": 11595,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.1145_1194delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu382fs",
"transcript": "XM_047442116.1",
"protein_id": "XP_047298072.1",
"transcript_support_level": null,
"aa_start": 382,
"aa_end": null,
"aa_length": 486,
"cds_start": 1145,
"cds_end": null,
"cds_length": 1461,
"cdna_start": 3696,
"cdna_end": null,
"cdna_length": 12757,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.866_915delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu289fs",
"transcript": "XM_024452383.2",
"protein_id": "XP_024308151.1",
"transcript_support_level": null,
"aa_start": 289,
"aa_end": null,
"aa_length": 393,
"cds_start": 866,
"cds_end": null,
"cds_length": 1182,
"cdna_start": 3071,
"cdna_end": null,
"cdna_length": 12132,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.866_915delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu289fs",
"transcript": "XM_047442117.1",
"protein_id": "XP_047298073.1",
"transcript_support_level": null,
"aa_start": 289,
"aa_end": null,
"aa_length": 393,
"cds_start": 866,
"cds_end": null,
"cds_length": 1182,
"cdna_start": 1712,
"cdna_end": null,
"cdna_length": 10773,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.866_915delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu289fs",
"transcript": "XM_047442118.1",
"protein_id": "XP_047298074.1",
"transcript_support_level": null,
"aa_start": 289,
"aa_end": null,
"aa_length": 393,
"cds_start": 866,
"cds_end": null,
"cds_length": 1182,
"cdna_start": 3026,
"cdna_end": null,
"cdna_length": 12087,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.866_915delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu289fs",
"transcript": "XM_047442119.1",
"protein_id": "XP_047298075.1",
"transcript_support_level": null,
"aa_start": 289,
"aa_end": null,
"aa_length": 393,
"cds_start": 866,
"cds_end": null,
"cds_length": 1182,
"cdna_start": 2757,
"cdna_end": null,
"cdna_length": 11818,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.866_915delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu289fs",
"transcript": "XM_047442120.1",
"protein_id": "XP_047298076.1",
"transcript_support_level": null,
"aa_start": 289,
"aa_end": null,
"aa_length": 393,
"cds_start": 866,
"cds_end": null,
"cds_length": 1182,
"cdna_start": 2657,
"cdna_end": null,
"cdna_length": 11718,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.866_915delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu289fs",
"transcript": "XM_047442121.1",
"protein_id": "XP_047298077.1",
"transcript_support_level": null,
"aa_start": 289,
"aa_end": null,
"aa_length": 393,
"cds_start": 866,
"cds_end": null,
"cds_length": 1182,
"cdna_start": 4106,
"cdna_end": null,
"cdna_length": 13167,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LLPPLPPPPPEPESSED",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.476_525delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu159fs",
"transcript": "XM_047442122.1",
"protein_id": "XP_047298078.1",
"transcript_support_level": null,
"aa_start": 159,
"aa_end": null,
"aa_length": 263,
"cds_start": 476,
"cds_end": null,
"cds_length": 792,
"cdna_start": 711,
"cdna_end": null,
"cdna_length": 9772,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.*517_*566delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": null,
"transcript": "ENST00000407218.5",
"protein_id": "ENSP00000384865.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 184,
"cds_start": -4,
"cds_end": null,
"cds_length": 555,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1174,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.*517_*566delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": null,
"transcript": "ENST00000415944.4",
"protein_id": "ENSP00000416267.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 172,
"cds_start": -4,
"cds_end": null,
"cds_length": 519,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1907,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"hgvs_c": "c.*517_*566delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": null,
"transcript": "ENST00000628176.2",
"protein_id": "ENSP00000486978.1",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": 172,
"cds_start": -4,
"cds_end": null,
"cds_length": 519,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1712,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "MECP2",
"gene_hgnc_id": 6990,
"dbsnp": "rs267608573",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 5.655,
"phylop100way_prediction": "Uncertain_significance",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 10,
"acmg_classification": "Pathogenic",
"acmg_criteria": "PVS1,PP5_Moderate",
"acmg_by_gene": [
{
"score": 10,
"benign_score": 0,
"pathogenic_score": 10,
"criteria": [
"PVS1",
"PP5_Moderate"
],
"verdict": "Pathogenic",
"transcript": "ENST00000453960.7",
"gene_symbol": "MECP2",
"hgnc_id": 6990,
"effects": [
"frameshift_variant"
],
"inheritance_mode": "XL,Unknown,AD",
"hgvs_c": "c.1181_1230delTGCTCCCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGAC",
"hgvs_p": "p.Leu394fs"
}
],
"clinvar_disease": "Rett syndrome",
"clinvar_classification": "Pathogenic",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "P:1",
"phenotype_combined": "Rett syndrome",
"pathogenicity_classification_combined": "Pathogenic",
"custom_annotations": null
}
],
"message": null
}