← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: X-154030636-CCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTG-C (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=X&pos=154030636&ref=CCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTG&alt=C&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "X",
      "pos": 154030636,
      "ref": "CCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTG",
      "alt": "C",
      "effect": "frameshift_variant",
      "transcript": "ENST00000453960.7",
      "consequences": [
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 3,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.1187_1227delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro396fs",
          "transcript": "NM_001110792.2",
          "protein_id": "NP_001104262.1",
          "transcript_support_level": null,
          "aa_start": 396,
          "aa_end": null,
          "aa_length": 498,
          "cds_start": 1187,
          "cds_end": null,
          "cds_length": 1497,
          "cdna_start": 1279,
          "cdna_end": null,
          "cdna_length": 10343,
          "mane_select": "ENST00000453960.7",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 3,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.1187_1227delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro396fs",
          "transcript": "ENST00000453960.7",
          "protein_id": "ENSP00000395535.2",
          "transcript_support_level": 1,
          "aa_start": 396,
          "aa_end": null,
          "aa_length": 498,
          "cds_start": 1187,
          "cds_end": null,
          "cds_length": 1497,
          "cdna_start": 1279,
          "cdna_end": null,
          "cdna_length": 10343,
          "mane_select": "NM_001110792.2",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.1151_1191delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro384fs",
          "transcript": "NM_004992.4",
          "protein_id": "NP_004983.1",
          "transcript_support_level": null,
          "aa_start": 384,
          "aa_end": null,
          "aa_length": 486,
          "cds_start": 1151,
          "cds_end": null,
          "cds_length": 1461,
          "cdna_start": 1403,
          "cdna_end": null,
          "cdna_length": 10467,
          "mane_select": null,
          "mane_plus": "ENST00000303391.11",
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.1151_1191delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro384fs",
          "transcript": "ENST00000303391.11",
          "protein_id": "ENSP00000301948.6",
          "transcript_support_level": 1,
          "aa_start": 384,
          "aa_end": null,
          "aa_length": 486,
          "cds_start": 1151,
          "cds_end": null,
          "cds_length": 1461,
          "cdna_start": 1403,
          "cdna_end": null,
          "cdna_length": 10467,
          "mane_select": null,
          "mane_plus": "NM_004992.4",
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.1151_1191delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro384fs",
          "transcript": "ENST00000630151.3",
          "protein_id": "ENSP00000486089.2",
          "transcript_support_level": 5,
          "aa_start": 384,
          "aa_end": null,
          "aa_length": 486,
          "cds_start": 1151,
          "cds_end": null,
          "cds_length": 1461,
          "cdna_start": 1388,
          "cdna_end": null,
          "cdna_length": 10452,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.872_912delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro291fs",
          "transcript": "NM_001316337.2",
          "protein_id": "NP_001303266.1",
          "transcript_support_level": null,
          "aa_start": 291,
          "aa_end": null,
          "aa_length": 393,
          "cds_start": 872,
          "cds_end": null,
          "cds_length": 1182,
          "cdna_start": 1571,
          "cdna_end": null,
          "cdna_length": 10635,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.872_912delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro291fs",
          "transcript": "NM_001369391.2",
          "protein_id": "NP_001356320.1",
          "transcript_support_level": null,
          "aa_start": 291,
          "aa_end": null,
          "aa_length": 393,
          "cds_start": 872,
          "cds_end": null,
          "cds_length": 1182,
          "cdna_start": 1866,
          "cdna_end": null,
          "cdna_length": 10930,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.872_912delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro291fs",
          "transcript": "NM_001369392.2",
          "protein_id": "NP_001356321.1",
          "transcript_support_level": null,
          "aa_start": 291,
          "aa_end": null,
          "aa_length": 393,
          "cds_start": 872,
          "cds_end": null,
          "cds_length": 1182,
          "cdna_start": 1515,
          "cdna_end": null,
          "cdna_length": 10579,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.872_912delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro291fs",
          "transcript": "NM_001369393.2",
          "protein_id": "NP_001356322.1",
          "transcript_support_level": null,
          "aa_start": 291,
          "aa_end": null,
          "aa_length": 393,
          "cds_start": 872,
          "cds_end": null,
          "cds_length": 1182,
          "cdna_start": 1391,
          "cdna_end": null,
          "cdna_length": 10455,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 3,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.872_912delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro291fs",
          "transcript": "NM_001369394.2",
          "protein_id": "NP_001356323.1",
          "transcript_support_level": null,
          "aa_start": 291,
          "aa_end": null,
          "aa_length": 393,
          "cds_start": 872,
          "cds_end": null,
          "cds_length": 1182,
          "cdna_start": 1322,
          "cdna_end": null,
          "cdna_length": 10386,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.692_732delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro231fs",
          "transcript": "ENST00000637917.2",
          "protein_id": "ENSP00000489847.2",
          "transcript_support_level": 5,
          "aa_start": 231,
          "aa_end": null,
          "aa_length": 333,
          "cds_start": 692,
          "cds_end": null,
          "cds_length": 1002,
          "cdna_start": 964,
          "cdna_end": null,
          "cdna_length": 1298,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.482_522delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro161fs",
          "transcript": "NM_001386137.1",
          "protein_id": "NP_001373066.1",
          "transcript_support_level": null,
          "aa_start": 161,
          "aa_end": null,
          "aa_length": 263,
          "cds_start": 482,
          "cds_end": null,
          "cds_length": 792,
          "cdna_start": 1406,
          "cdna_end": null,
          "cdna_length": 10470,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.482_522delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro161fs",
          "transcript": "NM_001386138.1",
          "protein_id": "NP_001373067.1",
          "transcript_support_level": null,
          "aa_start": 161,
          "aa_end": null,
          "aa_length": 263,
          "cds_start": 482,
          "cds_end": null,
          "cds_length": 792,
          "cdna_start": 1294,
          "cdna_end": null,
          "cdna_length": 10358,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.482_522delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro161fs",
          "transcript": "NM_001386139.1",
          "protein_id": "NP_001373068.1",
          "transcript_support_level": null,
          "aa_start": 161,
          "aa_end": null,
          "aa_length": 263,
          "cds_start": 482,
          "cds_end": null,
          "cds_length": 792,
          "cdna_start": 1170,
          "cdna_end": null,
          "cdna_length": 10234,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 3,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.1151_1191delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro384fs",
          "transcript": "XM_047442115.1",
          "protein_id": "XP_047298071.1",
          "transcript_support_level": null,
          "aa_start": 384,
          "aa_end": null,
          "aa_length": 486,
          "cds_start": 1151,
          "cds_end": null,
          "cds_length": 1461,
          "cdna_start": 2531,
          "cdna_end": null,
          "cdna_length": 11595,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.1151_1191delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro384fs",
          "transcript": "XM_047442116.1",
          "protein_id": "XP_047298072.1",
          "transcript_support_level": null,
          "aa_start": 384,
          "aa_end": null,
          "aa_length": 486,
          "cds_start": 1151,
          "cds_end": null,
          "cds_length": 1461,
          "cdna_start": 3693,
          "cdna_end": null,
          "cdna_length": 12757,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.872_912delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro291fs",
          "transcript": "XM_024452383.2",
          "protein_id": "XP_024308151.1",
          "transcript_support_level": null,
          "aa_start": 291,
          "aa_end": null,
          "aa_length": 393,
          "cds_start": 872,
          "cds_end": null,
          "cds_length": 1182,
          "cdna_start": 3068,
          "cdna_end": null,
          "cdna_length": 12132,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.872_912delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro291fs",
          "transcript": "XM_047442117.1",
          "protein_id": "XP_047298073.1",
          "transcript_support_level": null,
          "aa_start": 291,
          "aa_end": null,
          "aa_length": 393,
          "cds_start": 872,
          "cds_end": null,
          "cds_length": 1182,
          "cdna_start": 1709,
          "cdna_end": null,
          "cdna_length": 10773,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.872_912delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro291fs",
          "transcript": "XM_047442118.1",
          "protein_id": "XP_047298074.1",
          "transcript_support_level": null,
          "aa_start": 291,
          "aa_end": null,
          "aa_length": 393,
          "cds_start": 872,
          "cds_end": null,
          "cds_length": 1182,
          "cdna_start": 3023,
          "cdna_end": null,
          "cdna_length": 12087,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.872_912delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro291fs",
          "transcript": "XM_047442119.1",
          "protein_id": "XP_047298075.1",
          "transcript_support_level": null,
          "aa_start": 291,
          "aa_end": null,
          "aa_length": 393,
          "cds_start": 872,
          "cds_end": null,
          "cds_length": 1182,
          "cdna_start": 2754,
          "cdna_end": null,
          "cdna_length": 11818,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.872_912delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro291fs",
          "transcript": "XM_047442120.1",
          "protein_id": "XP_047298076.1",
          "transcript_support_level": null,
          "aa_start": 291,
          "aa_end": null,
          "aa_length": 393,
          "cds_start": 872,
          "cds_end": null,
          "cds_length": 1182,
          "cdna_start": 2654,
          "cdna_end": null,
          "cdna_length": 11718,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 3,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.872_912delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro291fs",
          "transcript": "XM_047442121.1",
          "protein_id": "XP_047298077.1",
          "transcript_support_level": null,
          "aa_start": 291,
          "aa_end": null,
          "aa_length": 393,
          "cds_start": 872,
          "cds_end": null,
          "cds_length": 1182,
          "cdna_start": 4103,
          "cdna_end": null,
          "cdna_length": 13167,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "PPLPPPPPEPESSE",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 2,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.482_522delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro161fs",
          "transcript": "XM_047442122.1",
          "protein_id": "XP_047298078.1",
          "transcript_support_level": null,
          "aa_start": 161,
          "aa_end": null,
          "aa_length": 263,
          "cds_start": 482,
          "cds_end": null,
          "cds_length": 792,
          "cdna_start": 708,
          "cdna_end": null,
          "cdna_length": 9772,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.*523_*563delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": null,
          "transcript": "ENST00000407218.5",
          "protein_id": "ENSP00000384865.2",
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 184,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 555,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1174,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.*523_*563delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": null,
          "transcript": "ENST00000415944.4",
          "protein_id": "ENSP00000416267.2",
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 172,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 519,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1907,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MECP2",
          "gene_hgnc_id": 6990,
          "hgvs_c": "c.*523_*563delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": null,
          "transcript": "ENST00000628176.2",
          "protein_id": "ENSP00000486978.1",
          "transcript_support_level": 3,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 172,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 519,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1712,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "MECP2",
      "gene_hgnc_id": 6990,
      "dbsnp": "rs63749024",
      "frequency_reference_population": null,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 0,
      "gnomad_exomes_af": null,
      "gnomad_genomes_af": null,
      "gnomad_exomes_ac": null,
      "gnomad_genomes_ac": null,
      "gnomad_exomes_homalt": null,
      "gnomad_genomes_homalt": null,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 5.655,
      "phylop100way_prediction": "Uncertain_significance",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 10,
      "acmg_classification": "Pathogenic",
      "acmg_criteria": "PVS1,PP5_Moderate",
      "acmg_by_gene": [
        {
          "score": 10,
          "benign_score": 0,
          "pathogenic_score": 10,
          "criteria": [
            "PVS1",
            "PP5_Moderate"
          ],
          "verdict": "Pathogenic",
          "transcript": "ENST00000453960.7",
          "gene_symbol": "MECP2",
          "hgnc_id": 6990,
          "effects": [
            "frameshift_variant"
          ],
          "inheritance_mode": "XL,Unknown,AD",
          "hgvs_c": "c.1187_1227delCACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG",
          "hgvs_p": "p.Pro396fs"
        }
      ],
      "clinvar_disease": "Rett syndrome",
      "clinvar_classification": "Pathogenic",
      "clinvar_review_status": "criteria provided, single submitter",
      "clinvar_submissions_summary": "P:1",
      "phenotype_combined": "Rett syndrome",
      "pathogenicity_classification_combined": "Pathogenic",
      "custom_annotations": null
    }
  ],
  "message": null
}