GBA1

glucosylceramidase beta 1, the group of Glycoside hydrolases|Glucosylceramidases

Basic information

Region (hg38): 1:155234452-155244699

Previous symbols: [ "GLUC", "GBA" ]

Links

ENSG00000177628 ∙ NCBI:2629 ∙ OMIM:606463 ∙ HGNC:4177 ∙ Uniprot:P04062 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• Gaucher disease (Definitive), mode of inheritance: AR
• Gaucher disease type I (Strong), mode of inheritance: AR
• Gaucher disease type III (Strong), mode of inheritance: AR
• Gaucher disease-ophthalmoplegia-cardiovascular calcification syndrome (Strong), mode of inheritance: AR
• Gaucher disease perinatal lethal (Strong), mode of inheritance: AR
• Gaucher disease type II (Strong), mode of inheritance: AR
• late-onset Parkinson disease (Strong), mode of inheritance: AD
• Gaucher disease-ophthalmoplegia-cardiovascular calcification syndrome (Supportive), mode of inheritance: AR
• Gaucher disease type I (Supportive), mode of inheritance: AR
• Gaucher disease type II (Supportive), mode of inheritance: AR
• Gaucher disease type III (Supportive), mode of inheritance: AR
• Gaucher disease perinatal lethal (Definitive), mode of inheritance: AR
• Gaucher disease perinatal lethal (Definitive), mode of inheritance: AR
• Gaucher disease type I (Strong), mode of inheritance: AR
• late-onset Parkinson disease (Limited), mode of inheritance: AD
• Parkinson disease (Definitive), mode of inheritance: AD
• Gaucher disease (Definitive), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Gaucher disease (types I, II, III, IIIC)	AR	Biochemical; Cardiovascular	Enzyme replacement (ERT) and substrate reduction therapy (SRT) is available, and can be effective in terms of hematologic, visceral, and skeletal manifestations; In addition to supportive care (which can include, for example, the need for RBC transfusions), splenectomy may be beneficial related to splenomegaly and thrombocytopenia in individuals for whom ERT/SRT is not available; BMT/HSCT has been reported in certain severe forms of disease (eg, type 3, which include neurological involvement); D409H homozygosity results in a phenotype involving specific cardiovascular manifestations, and early diagnosis and care of these manifestations may reduce morbidity and mortality	Biochemical; Cardiovascular; Gastrointestinal; Hematologic; Musculoskeletal; Neurologic; Ophthalmologic	13906837; 4713569; 870871; 7363908; 7138174; 7160406; 6507325; 3732318; 3950849; 2880291; 3385740; 3342593; 3353383; 2464926; 2308952; 2378352; 2023606; 1817041; 1897529; 1333717; 8434610; 8437594; 7475546; 7500785; 8118463; 8544197; 8544959; 7701581; 7942798; 8737974; 9011805; 9040001; 10636167; 10796875; 10649495; 10682310; 10685993; 11359469; 11241475; 11486896; 12133749; 12359135; 12970647; 12752568; 12595585; 14677062; 15525722; 15669682; 15690354; 16199246; 16630170; 15813845; 15734007; 15937077; 16601874; 16790605; 17464953; 17850633; 17878420; 18338393; 18332251; 19067373; 19286695; 19858467; 19846850; 20837857; 20301446; 21502868; 22375149; 22713811; 22916340; 23363328; 23536258; 23570288; 23683771; 23647506; 31130326; 33485799
Variants may also contribute to neurologic conditions such as Parkinson disease

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the GBA1 gene.

• Gaucher disease (30 variants)
• not provided (26 variants)
• Gaucher disease type I (14 variants)
• 7 conditions (8 variants)
• Gaucher disease perinatal lethal (5 variants)
• Gaucher disease type I;Gaucher disease type II;Gaucher disease type III;Gaucher disease-ophthalmoplegia-cardiovascular calcification syndrome (5 variants)
• not specified (5 variants)
• Parkinson disease, late-onset (4 variants)
• Gaucher disease type III (2 variants)
• Thrombocytopenia;Abnormal bleeding (1 variants)
• GBA1-related disorder (1 variants)
• Gaucher disease type II;Gaucher disease type III;Gaucher disease type I;Gaucher disease-ophthalmoplegia-cardiovascular calcification syndrome (1 variants)
• Gaucher disease type II (1 variants)
• See cases (1 variants)
• Lewy body dementia (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the GBA1 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			4	28		32
missense	18	57	90	3	1	169
nonsense	13	5	1			19
start loss						0
frameshift	12	7	1			20
inframe indel		1	2			3
splice donor/acceptor (+/-2bp)	1	5				6
splice region		1	2			3
non coding	1		7	5	3	16
Total	45	75	105	36	4

Highest pathogenic variant AF is 0.0000985

Variants in GBA1

This is a list of pathogenic ClinVar variants found in the GBA1 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
1-155234895-TGGCCCTGCTGTGCCCTCTTTAGTCACAGACAGCGTGTGAGCTGACTCTGTCCCTTTAATGCCCAGGCTGAGCCCAGTGCCTCCTTGAGTATCTGCTCCATCACTGGCGACGCCACAGGTAGGTGTGAATGGAGTAGCCAGGTGAGATTGTCTCCAGGAAGCCCACAGCA-T			Likely pathogenic (Sep 12, 2022)
1-155234903-C-T		7 conditions	Likely benign (Oct 04, 2021)
1-155235000-G-A			Pathogenic (Aug 26, 2020)
1-155235002-C-T		Gaucher disease type I • Gaucher disease • Gaucher disease-ophthalmoplegia-cardiovascular calcification syndrome;Gaucher disease type I;Gaucher disease type II;Gaucher disease type III • Parkinson disease, late-onset • not specified • 7 conditions	Pathogenic/Likely pathogenic (Jan 11, 2024)
1-155235003-G-A		Gaucher disease type I • Gaucher disease • Parkinson disease, late-onset	Pathogenic (Jun 01, 2023)
1-155235003-G-T			Uncertain significance (Sep 01, 2022)
1-155235005-C-T			Uncertain significance (Jan 31, 2024)
1-155235007-C-T		Gaucher disease type I • Gaucher disease	Pathogenic (Jun 15, 2023)
1-155235020-T-C		Parkinson disease, late-onset	Uncertain significance (Mar 18, 2020)
1-155235040-G-A		Gaucher disease	Uncertain significance (Aug 13, 2020)
1-155235057-C-T		Gaucher disease type I • not specified	Conflicting classifications of pathogenicity (May 29, 2024)
1-155235058-C-G		Gaucher disease	Uncertain significance (Aug 14, 2020)
1-155235069-C-T			Likely pathogenic (May 28, 2021)
1-155235072-T-A		not specified • Inborn genetic diseases	Conflicting classifications of pathogenicity (Jul 28, 2020)
1-155235091-C-T		not specified	Likely benign (Jan 31, 2020)
1-155235101-C-T		Gaucher disease perinatal lethal	Pathogenic (Jul 15, 2004)
1-155235107-A-G			Uncertain significance (Jul 06, 2016)
1-155235109-CA-TC		7 conditions	Uncertain significance (Jun 18, 2024)
1-155235112-G-A		not specified	Conflicting classifications of pathogenicity (Jun 28, 2021)
1-155235185-T-A			Uncertain significance (Jan 26, 2015)
1-155235193-A-G			Pathogenic (Oct 01, 2024)
1-155235193-A-T		Gaucher disease	Likely pathogenic (Jun 15, 2022)
1-155235195-C-T		Gaucher disease • Gaucher disease type I • Gaucher disease type I;Gaucher disease type II;Gaucher disease type III;Gaucher disease-ophthalmoplegia-cardiovascular calcification syndrome	Pathogenic/Likely pathogenic (Jan 19, 2024)
1-155235196-G-A		Gaucher disease type III • Parkinson disease, late-onset • Gaucher disease type II • Gaucher disease type I • Gaucher disease • 7 conditions • GBA1-related disorder • Gaucher disease-ophthalmoplegia-cardiovascular calcification syndrome;Gaucher disease type I;Gaucher disease type II;Gaucher disease type III • not specified	Pathogenic (Jan 17, 2024)
1-155235197-G-C		Gaucher disease type II	Likely pathogenic (Jul 13, 2021)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
GBA1	protein_coding	protein_coding	ENST00000327247	11	10248

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.00000144	0.991	125706	0	42	125748	0.000167

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	1.17	248	306	0.811	0.0000184	3487
Missense in Polyphen		47	89.407	0.52568		1117
Synonymous	-0.397	125	119	1.05	0.00000707	1082
Loss of Function	2.36	14	27.3	0.512	0.00000152	288

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.0000578	0.0000578
Ashkenazi Jewish	0.000198	0.000198
East Asian	0.000221	0.000217
Finnish	0.000139	0.000139
European (Non-Finnish)	0.000215	0.000211
Middle Eastern	0.000221	0.000217
South Asian	0.000196	0.000196
Other	0.000163	0.000163

dbNSFP

Source: dbNSFP

• Disease: DISEASE: Gaucher disease (GD) [MIM:230800]: A lysosomal storage disease due to deficient activity of beta-glucocerebrosidase and characterized by accumulation of glucosylceramide in the reticulo- endothelial system. Different clinical forms are recognized depending on the presence (neuronopathic forms) or absence of central nervous system involvement, severity and age of onset. {ECO:0000269|PubMed:10352942, ECO:0000269|PubMed:10360404, ECO:0000269|PubMed:10447266, ECO:0000269|PubMed:10744424, ECO:0000269|PubMed:10796875, ECO:0000269|PubMed:11933202, ECO:0000269|PubMed:11992489, ECO:0000269|PubMed:12204005, ECO:0000269|PubMed:15292921, ECO:0000269|PubMed:15826241, ECO:0000269|PubMed:16293621, ECO:0000269|PubMed:17620502, ECO:0000269|PubMed:18332251, ECO:0000269|PubMed:1972019, ECO:0000269|PubMed:1974409, ECO:0000269|PubMed:19846850, ECO:0000269|PubMed:7627184, ECO:0000269|PubMed:7627192, ECO:0000269|PubMed:7916532, ECO:0000269|PubMed:8076951, ECO:0000269|PubMed:8112750, ECO:0000269|PubMed:8294033, ECO:0000269|PubMed:8432537, ECO:0000269|PubMed:8790604, ECO:0000269|PubMed:8829654, ECO:0000269|PubMed:8829663, ECO:0000269|PubMed:8937765, ECO:0000269|PubMed:9061570, ECO:0000269|PubMed:9153297, ECO:0000269|PubMed:9182788, ECO:0000269|PubMed:9217217, ECO:0000269|PubMed:9279145, ECO:0000269|PubMed:9516376, ECO:0000269|PubMed:9554454, ECO:0000269|PubMed:9554746, ECO:0000269|PubMed:9650766, ECO:0000269|PubMed:9683600}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Gaucher disease 1 (GD1) [MIM:230800]: A form of Gaucher disease characterized by hepatosplenomegaly with consequent anemia and thrombopenia, and bone involvement. The central nervous system is not involved. {ECO:0000269|PubMed:10206680, ECO:0000269|PubMed:10340647, ECO:0000269|PubMed:15605411, ECO:0000269|PubMed:8889591, ECO:0000269|Ref.14}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Gaucher disease 2 (GD2) [MIM:230900]: The most severe form of Gaucher disease. It manifests soon after birth, with death generally occurring before patients reach two years of age. {ECO:0000269|PubMed:9637431, ECO:0000269|PubMed:9851895}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Gaucher disease 3 (GD3) [MIM:231000]: A subacute form of neuronopathic Gaucher disease. It has later onset and slower progression compared to the acute form of neuronopathic Gaucher disease 2. {ECO:0000269|PubMed:8780099}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Gaucher disease 3C (GD3C) [MIM:231005]: A variant of subacute neuronopathic Gaucher disease 3 associated with cardiovascular calcifications. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Gaucher disease perinatal lethal (GDPL) [MIM:608013]: Distinct form of Gaucher disease type 2, characterized by fetal onset. Hydrops fetalis, in utero fetal death and neonatal distress are prominent features. When hydrops is absent, neurologic involvement begins in the first week and leads to death within 3 months. Hepatosplenomegaly is a major sign, and is associated with ichthyosis, arthrogryposis, and facial dysmorphism. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Note=Perinatal lethal Gaucher disease is associated with non-immune hydrops fetalis, a generalized edema of the fetus with fluid accumulation in the body cavities due to non-immune causes. Non-immune hydrops fetalis is not a diagnosis in itself but a symptom, a feature of many genetic disorders, and the end-stage of a wide variety of disorders.; DISEASE: Parkinson disease (PARK) [MIM:168600]: A complex neurodegenerative disorder characterized by bradykinesia, resting tremor, muscular rigidity and postural instability. Additional features are characteristic postural abnormalities, dysautonomia, dystonic cramps, and dementia. The pathology of Parkinson disease involves the loss of dopaminergic neurons in the substantia nigra and the presence of Lewy bodies (intraneuronal accumulations of aggregated proteins), in surviving neurons in various areas of the brain. The disease is progressive and usually manifests after the age of 50 years, although early-onset cases (before 50 years) are known. The majority of the cases are sporadic suggesting a multifactorial etiology based on environmental and genetic factors. However, some patients present with a positive family history for the disease. Familial forms of the disease usually begin at earlier ages and are associated with atypical clinical features. {ECO:0000269|PubMed:12847165, ECO:0000269|PubMed:16148263, ECO:0000269|PubMed:19286695}. Note=Disease susceptibility may be associated with variations affecting the gene represented in this entry.
• Pathway: Lysosome - Homo sapiens (human);Other glycan degradation - Homo sapiens (human);Sphingolipid metabolism - Homo sapiens (human);Sphingolipid Metabolism;Gaucher Disease;Globoid Cell Leukodystrophy;Metachromatic Leukodystrophy (MLD);Fabry disease;Krabbe disease;Sphingolipid Metabolism;Metabolism of lipids;Metabolism of proteins;Chaperonin-mediated protein folding;Metabolism;Association of TriC/CCT with target proteins during biosynthesis;Glycosphingolipid metabolism;Protein folding;Glycosphingolipid metabolism;Sphingolipid metabolism (Consensus)

Recessive Scores

• pRec: 0.636

Intolerance Scores

• loftool: 0.00827
• rvis_EVS: 0.18
• rvis_percentile_EVS: 66.13

Haploinsufficiency Scores

• pHI: 0.0879
• hipred: Y
• hipred_score: 0.655
• ghis: 0.428

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.973

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Gba
• Phenotype: homeostasis/metabolism phenotype; cellular phenotype; growth/size/body region phenotype; normal phenotype; integument phenotype (the observable morphological and physiological characteristics of the skin and its associated structures, such as the hair, nails, sweat glands, sebaceous glands and other secretory glands that are manifested through development and lifespan); pigmentation phenotype; endocrine/exocrine gland phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); immune system phenotype; skeleton phenotype; respiratory system phenotype; liver/biliary system phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); hematopoietic system phenotype; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span)

Zebrafish Information Network

• Gene name: gba
• Affected structure: macrophage
• Phenotype tag: abnormal
• Phenotype quality: morphology

Gene ontology

• Biological process: glucosylceramide catabolic process;mitochondrion organization;cellular response to starvation;response to pH;regulation of macroautophagy;termination of signal transduction;neuron projection development;regulation of cellular protein metabolic process;positive regulation of proteasomal ubiquitin-dependent protein catabolic process;negative regulation of protein homooligomerization;negative regulation of interleukin-6 production;regulation of water loss via skin;response to testosterone;positive regulation of protein dephosphorylation;cell death in response to oxidative stress;positive regulation of protein complex disassembly;negative regulation of MAP kinase activity;skin morphogenesis;response to estrogen;sphingosine biosynthetic process;ceramide biosynthetic process;negative regulation of inflammatory response;positive regulation of protein metabolic process;cellular response to tumor necrosis factor;response to dexamethasone;response to thyroid hormone;negative regulation of neuron death;beta-glucoside catabolic process;positive regulation of proteolysis involved in cellular protein catabolic process;positive regulation of protein lipidation;positive regulation of neuronal action potential;positive regulation of autophagy of mitochondrion in response to mitochondrial depolarization;autophagosome organization;regulation of lysosomal protein catabolic process
• Cellular component: lysosome;lysosomal membrane;extrinsic component of membrane;lysosomal lumen;extracellular exosome
• Molecular function: glucosylceramidase activity;signaling receptor binding;scavenger receptor binding;protein binding;hydrolase activity