1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant names:

• chr1-154869723-G-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT
• rs3831942
• NM_002249.6:c.209_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC

Variant summary

Our verdict is Likely benign. The variant received -3 ACMG points: 2P and 5B. PP5_Moderate BP3 BS2

The NM_002249.6(KCNN3):​c.209_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC​(p.Gln70_Gln80dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency:
  • Genomes: 𝑓 0.00059 (2 hom., cov: 0)
  • Exomes 𝑓: 0.00017 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: KCNN3 NM_002249.6 conservative_inframe_insertion
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 2.12
• Publications: 18 publications found

Genes affected

KCNN3 (HGNC:6292): (potassium calcium-activated channel subfamily N member 3) Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]

KCNN3 Gene-Disease associations (from GenCC):

• Zimmermann-Laband syndrome 3

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• Zimmermann-Laband syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• schizophrenia

  Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ENSG00000308854 (HGNC:):

ACMG classification

Our verdict: Likely_benign. The variant received -3 ACMG points.

• PP5: Variant 1-154869723-G-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT is Pathogenic according to our data. Variant chr1-154869723-G-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 3910119.Status of the report is criteria_provided_single_submitter, 1 stars.
• BP3: Nonframeshift variant in repetitive region in NM_002249.6
• BS2: High Homozygotes in GnomAd4 at 2 Unknown,AD,AR gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002249.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNN3	NM_002249.6	MANE Select	c.209_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln70_Gln80dup	conservative_inframe_insertion	Exon 1 of 8	NP_002240.3
	KCNN3	NM_001204087.2		c.209_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln70_Gln80dup	conservative_inframe_insertion	Exon 1 of 9	NP_001191016.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNN3	ENST00000271915.9	TSL:1 MANE Select	c.209_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln70_Gln80dup	conservative_inframe_insertion	Exon 1 of 8	ENSP00000271915.3
	KCNN3	ENST00000618040.4	TSL:5	c.209_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln70_Gln80dup	conservative_inframe_insertion	Exon 1 of 9	ENSP00000481848.1
	ENSG00000308854	ENST00000836873.1		n.195-649_195-617dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron	N/A

Frequencies

GnomAD3 genomes AF: 0.000595 AC: 84 AN: 141286 Hom.: 2 Cov.: 0

Gnomad AFR AF: 0.00122

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000424

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00216

Gnomad SAS AF: 0.00222

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000199

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000173 AC: 236 AN: 1365110 Hom.: 0 Cov.: 112 AF XY: 0.000207 AC XY: 140 AN XY: 674876

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000482 AC: 15 AN: 31108

American (AMR) AF: 0.000225 AC: 8 AN: 35514

Ashkenazi Jewish (ASJ) AF: 0.0000401 AC: 1 AN: 24960

East Asian (EAS) AF: 0.00160 AC: 57 AN: 35560

South Asian (SAS) AF: 0.00117 AC: 92 AN: 78748

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 46140

Middle Eastern (MID) AF: 0.000226 AC: 1 AN: 4432

European-Non Finnish (NFE) AF: 0.0000494 AC: 52 AN: 1051844

Other (OTH) AF: 0.000176 AC: 10 AN: 56804

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.000594 AC: 84 AN: 141388 Hom.: 2 Cov.: 0 AF XY: 0.000647 AC XY: 44 AN XY: 68016

African (AFR) AF: 0.00122 AC: 46 AN: 37840

American (AMR) AF: 0.000424 AC: 6 AN: 14158

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3376

East Asian (EAS) AF: 0.00217 AC: 10 AN: 4614

South Asian (SAS) AF: 0.00223 AC: 9 AN: 4042

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 9120

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 282

European-Non Finnish (NFE) AF: 0.000199 AC: 13 AN: 65184

Other (OTH) AF: 0.00 AC: 0 AN: 1902

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Feb 16, 2025

Laboratory of Genetics, Children's Clinical University Hospital Latvia

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.1
Mutation Taster		=75/25	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3831942; hg19: chr1-154842199;