1-209432291-TAGCAGCAGCAGCAGCAGCAGCAGCAGC-T
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The ENST00000366437.8(MIR205HG):n.653_679delGCAGCAGCAGCAGCAGCAGCAGCAGCA variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000173 in 1,333,130 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
ENST00000366437.8 non_coding_transcript_exon
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| MIR205HG | NR_145433.1 | n.599_625delGCAGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon_variant | Exon 3 of 3 | ||||
| MIR205HG | NR_145434.1 | n.734_760delGCAGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon_variant | Exon 5 of 5 | ||||
| MIR205HG | NR_145435.1 | n.682_708delGCAGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon_variant | Exon 4 of 4 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| MIR205HG | ENST00000366437.8 | n.653_679delGCAGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon_variant | Exon 4 of 4 | 3 | |||||
| MIR205HG | ENST00000429156.7 | n.764_790delGCAGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon_variant | Exon 5 of 5 | 3 | |||||
| MIR205HG | ENST00000431096.7 | n.685_711delGCAGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon_variant | Exon 4 of 4 | 3 |
Frequencies
GnomAD3 genomes AF: 0.0000535 AC: 8AN: 149472Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.0000118 AC: 14AN: 1183548Hom.: 0 AF XY: 0.0000171 AC XY: 10AN XY: 585122 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000602 AC: 9AN: 149582Hom.: 0 Cov.: 0 AF XY: 0.0000685 AC XY: 5AN XY: 72968 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at