1-209432291-TAGCAGCAGCAGCAGCAGCAGCAGCAGC-TAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC

Variant names:

• chr1-209432291-T-TAGCAGCAGCAGCAGCAGCAGC
• rs3842530
• ENST00000366437.8:n.659_679dupGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000366437.8(MIR205HG):​n.659_679dupGCAGCAGCAGCAGCAGCAGCA variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00010 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000052 (3 hom.)
  • Failed GnomAD Quality Control
• Consequence: MIR205HG ENST00000366437.8 non_coding_transcript_exon
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.00
• Publications: 10 publications found

Genes affected

MIR205HG (HGNC:43562): (MIR205 host gene)

MIR205 (HGNC:31583): (microRNA 205) microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000366437.8. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MIR205HG	NR_145433.1		n.605_625dupGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon	Exon 3 of 3
	MIR205HG	NR_145434.1		n.740_760dupGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon	Exon 5 of 5
	MIR205HG	NR_145435.1		n.688_708dupGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon	Exon 4 of 4

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MIR205HG	ENST00000366437.8	TSL:3	n.659_679dupGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon	Exon 4 of 4
	MIR205HG	ENST00000429156.7	TSL:3	n.770_790dupGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon	Exon 5 of 5
	MIR205HG	ENST00000431096.7	TSL:3	n.691_711dupGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon	Exon 4 of 4

Frequencies

GnomAD3 genomes AF: 0.0000937 AC: 14 AN: 149472 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000199

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000888

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000524 AC: 62 AN: 1183544 Hom.: 3 Cov.: 0 AF XY: 0.0000513 AC XY: 30 AN XY: 585122

African (AFR) AF: 0.000232 AC: 6 AN: 25904

American (AMR) AF: 0.0000294 AC: 1 AN: 34060

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 16278

East Asian (EAS) AF: 0.0000610 AC: 1 AN: 16400

South Asian (SAS) AF: 0.00 AC: 0 AN: 81278

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 30016

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4160

European-Non Finnish (NFE) AF: 0.0000558 AC: 52 AN: 932546

Other (OTH) AF: 0.0000466 AC: 2 AN: 42902

GnomAD4 genome AF: 0.000100 AC: 15 AN: 149582 Hom.: 0 Cov.: 0 AF XY: 0.0000959 AC XY: 7 AN XY: 72968

African (AFR) AF: 0.000223 AC: 9 AN: 40278

American (AMR) AF: 0.00 AC: 0 AN: 15046

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3456

East Asian (EAS) AF: 0.00 AC: 0 AN: 5034

South Asian (SAS) AF: 0.00 AC: 0 AN: 4630

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10334

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 292

European-Non Finnish (NFE) AF: 0.0000888 AC: 6 AN: 67532

Other (OTH) AF: 0.00 AC: 0 AN: 2080

Alfa AF: 0.00 Hom.: 2701

Bravo AF: 0.0000378

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3842530; hg19: chr1-209605636;