1-45331800-CCAGGGCTCCGAGGGAGGCAGGCA-C

Position:

• chr1-45331800-CCAGGGCTCCGAGGGAGGCAGGCA-C

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_001048174.2(MUTYH):​c.940_962delTGCCTGCCTCCCTCGGAGCCCTG​(p.Cys314fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: MUTYH NM_001048174.2 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 7.53

Genes affected

MUTYH (HGNC:7527): (mutY DNA glycosylase) This gene encodes a DNA glycosylase involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA lesion. The protein is localized to the nucleus and mitochondria. This gene product is thought to play a role in signaling apoptosis by the introduction of single-strand breaks following oxidative damage. Mutations in this gene result in heritable predisposition to colorectal cancer, termed MUTYH-associated polyposis (MAP). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2017]

ENSG00000288208 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 1-45331800-CCAGGGCTCCGAGGGAGGCAGGCA-C is Pathogenic according to our data. Variant chr1-45331800-CCAGGGCTCCGAGGGAGGCAGGCA-C is described in ClinVar as [Pathogenic]. Clinvar id is 533319.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MUTYH	NM_001048174.2	c.940_962delTGCCTGCCTCCCTCGGAGCCCTG	p.Cys314fs	frameshift_variant	12/16	ENST00000456914.7	NP_001041639.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MUTYH	ENST00000456914.7	c.940_962delTGCCTGCCTCCCTCGGAGCCCTG	p.Cys314fs	frameshift_variant	12/16	1	NM_001048174.2	ENSP00000407590.2
ENSG00000288208	ENST00000671898.1	n.1528_1550delTGCCTGCCTCCCTCGGAGCCCTG		non_coding_transcript_exon_variant	16/21			ENSP00000499896.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Familial adenomatous polyposis 2 Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

May 04, 2021

For these reasons, this variant has been classified as Pathogenic. Several different frameshift variants downstream of this variant (p.Pro367Glnfs*164, p.Pro405Leufs*123, and p.Ser518Alafs*54) have been determined to be likely pathogenic or pathogenic (Invitae). These truncations disrupts the conserved PCNA binding motif of MUTYH (Gln526-Phe533, also known as Gln512-Phe519 in the literature because of transcript nomenclature differences), which has been shown to be critical for MUTYH-PCNA binding (PMID: 11092888, 26377631). This suggests that disruption of this region of the MUTYH protein is causative of disease. This variant has not been reported in the literature in individuals with MUTYH-related disease. This variant is not present in population databases (ExAC no frequency). This sequence change results in a premature translational stop signal in the MUTYH gene (p.Cys342Glyfs*182). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 208 amino acids of the MUTYH protein. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553126848; hg19: chr1-45797472;