10-88761718-GCTATCTATCTATCTATCTATCTAT-GCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTAT

Variant names:

• chr10-88761718-G-GCTATCTATCTATCTATCTAT
• rs71022539
• NM_001102469.2:c.108+230_108+249dupCTATCTATCTATCTATCTAT

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_001102469.2(LIPN):​c.108+230_108+249dupCTATCTATCTATCTATCTAT variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.000014 (0 hom., cov: 0)
• Consequence: LIPN NM_001102469.2 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -0.694
• Publications: 0 publications found

Genes affected

LIPN (HGNC:23452): (lipase family member N) The gene encodes a lipase that is highly expressed in granular keratinocytes in the epidermis, and plays a role in the differentiation of keratinocytes. Mutations in this gene are associated with lamellar ichthyosis type 4. [provided by RefSeq, Dec 2011]

LIPN Gene-Disease associations (from GenCC):

• autosomal recessive congenital ichthyosis 8

  Inheritance: Unknown, AR Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), G2P
• lamellar ichthyosis

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001102469.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LIPN	NM_001102469.2	MANE Select	c.108+230_108+249dupCTATCTATCTATCTATCTAT		intron	N/A	NP_001095939.1	Q5VXI9

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LIPN	ENST00000404459.2	TSL:1 MANE Select	c.108+205_108+206insCTATCTATCTATCTATCTAT		intron	N/A	ENSP00000383923.1	Q5VXI9
	LIPN	ENST00000674982.1		n.241+205_241+206insCTATCTATCTATCTATCTAT		intron	N/A

Frequencies

GnomAD3 genomes AF: 0.0000137 AC: 2 AN: 145754 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000219

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000151

Gnomad OTH AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.0000137 AC: 2 AN: 145754 Hom.: 0 Cov.: 0 AF XY: 0.0000141 AC XY: 1 AN XY: 70814

African (AFR) AF: 0.00 AC: 0 AN: 39292

American (AMR) AF: 0.00 AC: 0 AN: 14326

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3376

East Asian (EAS) AF: 0.00 AC: 0 AN: 4970

South Asian (SAS) AF: 0.000219 AC: 1 AN: 4572

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 9868

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 310

European-Non Finnish (NFE) AF: 0.0000151 AC: 1 AN: 66200

Other (OTH) AF: 0.00 AC: 0 AN: 1978

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.69

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71022539; hg19: chr10-90521475;