11-2884840-TCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGG-TCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGGCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGG

Variant names:

• chr11-2884840-T-TCCGGGGCCGGGGCCGGGGCGGGGGCCGGGGCCGGGG
• rs878853638
• NM_001122630.2:c.581_616dupCCCCGGCCCCGGCCCCCGCCCCGGCCCCGGCCCCGG

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PM1 BP3

The NM_001122630.2(CDKN1C):​c.581_616dupCCCCGGCCCCGGCCCCCGCCCCGGCCCCGGCCCCGG​(p.Ala194_Pro205dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. D206D) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: CDKN1C NM_001122630.2 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: -0.198
• Publications: 0 publications found

Genes affected

CDKN1C (HGNC:1786): (cyclin dependent kinase inhibitor 1C) This gene is imprinted, with preferential expression of the maternal allele. The encoded protein is a tight-binding, strong inhibitor of several G1 cyclin/Cdk complexes and a negative regulator of cell proliferation. Mutations in this gene are implicated in sporadic cancers and Beckwith-Wiedemann syndorome, suggesting that this gene is a tumor suppressor candidate. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]

CDKN1C Gene-Disease associations (from GenCC):

• Beckwith-Wiedemann syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• IMAGe syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Illumina, G2P, Ambry Genetics
• rhabdomyosarcoma

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• Beckwith-Wiedemann syndrome due to CDKN1C mutation

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• intrauterine growth restriction-short stature-early adult-onset diabetes syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Silver-Russell syndrome

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PM1: In a hotspot region, there are 3 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 1 benign, 37 uncertain in NM_001122630.2
• BP3: Nonframeshift variant in repetitive region in NM_001122630.2

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CDKN1C	NM_001122630.2	c.581_616dupCCCCGGCCCCGGCCCCCGCCCCGGCCCCGGCCCCGG	p.Ala194_Pro205dup	conservative_inframe_insertion	Exon 2 of 4	ENST00000440480.8	NP_001116102.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CDKN1C	ENST00000440480.8	c.581_616dupCCCCGGCCCCGGCCCCCGCCCCGGCCCCGGCCCCGG	p.Ala194_Pro205dup	conservative_inframe_insertion	Exon 2 of 4	1	NM_001122630.2	ENSP00000411257.2

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 22

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Beckwith-Wiedemann syndrome Uncertain:1

Sep 21, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.614_649dup, results in the insertion of 12 amino acid(s) of the CDKN1C protein (p.Ala205_Pro216dup), but otherwise preserves the integrity of the reading frame. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This variant has not been reported in the literature in individuals affected with CDKN1C-related conditions. This variant is not present in population databases (gnomAD no frequency). -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.20

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs878853638; hg19: chr11-2906070;